Previous Contig 006546:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048C12Sequence390006546 (3)gb:AB005249_15096575e-08Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXM12.>gb:BT015345_1642243010797 (3)
JMSF028N04Sequence647006546 (3)gb:AB005249_15096572e-12Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXM12.>gb:BT015345_1642704010797 (3)gb:AB005249_15096576e-60Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXM12.>gb:BT015345_1642
JMSF035M12Sequence632006546 (3)gb:AB005249_15096572e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXM12.>gb:BT015345_1642763010797 (3)gb:AB005249_15096574e-70Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXM12.>gb:BT015345_1642

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035M12+ TGTCTCCCGTGTAATGC
                      ____________________________________________________________
consensus TGTCTCCCGTGTAATGC
 
. : . : . : . : . : . :
JMSF035M12+ ATTCAAACCGAATGTAACAAGTCCTCCCGTCCTCTTGAAAAAGCTGTTTAGCTTATCCCA
                      ____________________________________________________________
consensus ATTCAAACCGAATGTAACAAGTCCTCCCGTCCTCTTGAAAAAGCTGTTTAGCTTATCCCA
 
. : . : . : . : . : . :
JMSF035M12+ CCTATCCATAGGTAGGCATCCATTAGAAAATCCAAACAGCCCGTCCTTCTGCTTTCTAAA
                      ____________________________________________________________
consensus CCTATCCATAGGTAGGCATCCATTAGAAAATCCAAACAGCCCGTCCTTCTGCTTTCTAAA
 
. : . : . : . : . : . :
JMSF035M12+ TGGATGGCAGGGAGTCTTCAGATTGCCCACATCATAAAGAACTTGGTCTTGCAATGAACC
                      ____________________________________________________________
consensus TGGATGGCAGGGAGTCTTCAGATTGCCCACATCATAAAGAACTTGGTCTTGCAATGAACC
 
. : . : . : . : . : . :
JMSF035M12+ CCCGAGCCGCAATCTCAAATGCTCAAAAGCTTGAATAGCCTTGGCAAAAAAGGGGTGAGA
                      ____________________________________________________________
consensus CCCGAGCCGCAATCTCAAATGCTCAAAAGCTTGAATAGCCTTGGCAAAAAAGGGGTGAGA
 
. : . : . : . : . : . :
JMSF035M12+ TAAATCCAAGTTTAACACAGAAGATGACTCCCAAGGGCATTGGTTGTAGTTACACTTCTC
JMFF048C12+ GTAGTTACACTTCTC
JMSF028N04+ AACACAGAAGATGACTCCCAAGGGCATTGGTTGTAGTTACACTTCTC
                      ____________________________________________________________
consensus TAAATCCAAGTTTAACACAGAAGATGACTCCCAAGGGCATTGGTTGTAGTTACACTTCTC
 
. : . : . : . : . : . :
JMSF035M12+ GTGAGGCCACCAATCAATGGTAGCACATATATAATTAGCATCCGTATCCGAAATCCTTGC
JMFF048C12+ GTGAGGCCACCAATCAATGGTAGCACATATATAATTAGCATCCGTATCCGAAATCCTTGC
JMSF028N04+ GTGAGGCCACCAATCAATGGTAGCACATATATAATTAGCGTCCGTATCCGAAATCCTTGC
                      ____________________________________________________________
consensus GTGAGGCCACCAATCAATGGTAGCACATATATAATTAGCATCCGTATCCGAAATCCTTGC
 
. : . : . : . : . : . :
JMSF035M12+ AGTTGTTTCAATTAGAAGTTCAGCATGTTCGATAGTTTGTGTTAATGCTGTGGGAAAAAG
JMFF048C12+ AGTTGTTTCAATTAGAAGTTCAGCATGTTCGATAGTTTGTGTTAATGCTGTGGGAAAAAG
JMSF028N04+ AGTTGTTTCAATTAGAAGTTCAGCATGTTCGATAGTTTGTGTTAATGCTGTGGGAAAAAG
                      ____________________________________________________________
consensus AGTTGTTTCAATTAGAAGTTCAGCATGTTCGATAGTTTGTGTTAATGCTGTGGGAAAAAG
 
. : . : . : . : . : . :
JMSF035M12+ TGCCAAAAAGAGTAACAATACAGCTGGGAAGTGCATTGATTATTGAACCCCAGAGCTTCA
JMFF048C12+ TGCCAAAAAGAGTAACAATACAGCTGGGAAGTGCATTGATTATTGAACCCCAGAGCTTCA
JMSF028N04+ TGCCAAAAAGAGTAACAATACAGCTGGGAAGTGCATTGATTATTGAACCCCAGAGCTTCA
                      ____________________________________________________________
consensus TGCCAAAAAGAGTAACAATACAGCTGGGAAGTGCATTGATTATTGAACCCCAGAGCTTCA
 
. : . : . : . : . : . :
JMSF035M12+ CCACTAGCT
JMFF048C12+ CCACTAGCT
JMSF028N04+ CCACTAGCTGGTTGGAGGATTGTTGGGCAGAGGCCGGTAAAGGGCTTAATATGCCAAGTC
                      ____________________________________________________________
consensus CCACTAGCTGGTTGGAGGATTGTTGGGCAGAGGCCGGTAAAGGGCTTAATATGCCAAGTC
 
. : . : . : . : . : . :
JMSF028N04+ CAGCACCCAGCGTCTCGAAAATGTGTGGCGGTACAAAGAAATAAAGTTGAACCTTCGCTA
                      ____________________________________________________________
consensus CAGCACCCAGCGTCTCGAAAATGTGTGGCGGTACAAAGAAATAAAGTTGAACCTTCGCTA
 
. : . : . : . : . : . :
JMSF028N04+ CTAGCTATAGTTTTTTAGGTGAGTGGTAAGCGCTCGGTCTCCAAGCTAAAACACAGTAGA
                      ____________________________________________________________
consensus CTAGCTATAGTTTTTTAGGTGAGTGGTAAGCGCTCGGTCTCCAAGCTAAAACACAGTAGA
 
. : . : . : . : . : . :
JMSF028N04+ ATTAAGACGCAGGGAGAAATCCGAAGCTTCCCAGAGCCAAGTGCATTAAAATTATGCAAA
                      ____________________________________________________________
consensus ATTAAGACGCAGGGAGAAATCCGAAGCTTCCCAGAGCCAAGTGCATTAAAATTATGCAAA
 
. : . : . : . : . : . :
JMSF028N04+ ACCCAGATGAGAAGTAACCCCGAAGACTACAAATCCGCCATTAATGAGCTGAACTTCTGT
                      ____________________________________________________________
consensus ACCCAGATGAGAAGTAACCCCGAAGACTACAAATCCGCCATTAATGAGCTGAACTTCTGT
 
. : . : . : . : . : . :
JMSF028N04+ ACAGCATACACCAATACTGGGAAGCGCGAAACACAATTTTGCTAAAAGATAATCCTTTTG
                      ____________________________________________________________
consensus ACAGCATACACCAATACTGGGAAGCGCGAAACACAATTTTGCTAAAAGATAATCCTTTTG
 
. : . : . : . : . : . :
JMSF028N04+ TTTTTTCTCTCACTAAAATGCATAACACAAGTGACAAGTGTGTCAANAGCGTCATGCTCC
                      ____________________________________________________________
consensus TTTTTTCTCTCACTAAAATGCATAACACAAGTGACAAGTGTGTCAANAGCGTCATGCTCC