Previous Contig 006544:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS059D04Sequence641006544 (5)gb:AY099759_15767843e-78Arabidopsis thaliana unknown protein (At2g22400) mRNA, complete cds.
JMFS072H02Sequence627006544 (5)gb:AY099759_15767843e-77Arabidopsis thaliana unknown protein (At2g22400) mRNA, complete cds.
JMFS166C04Sequence550006544 (5)gb:AY099759_15767842e-57Arabidopsis thaliana unknown protein (At2g22400) mRNA, complete cds.
JMSF025E22Sequence641006544 (5)gb:AY099759_15767844e-67Arabidopsis thaliana unknown protein (At2g22400) mRNA, complete cds.725023165gb:AP005573_18542765e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ15
JMSF028L10Sequence671006544 (5)gb:AY099759_15767844e-67Arabidopsis thaliana unknown protein (At2g22400) mRNA, complete cds.323023343gb:AP005573_18542760.004Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ15

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS072H02+ GGAGCTGCACA
JMFS059D04+ TTGAAATGTTTCGAACCAGGAGCTGCACA
JMSF025E22+ GGAGCTGCACA
JMSF028L10+ GGAGCTGCACA
                      ____________________________________________________________
consensus TTGAAATGTTTCGAACCAGGAGCTGCACA
 
. : . : . : . : . : . :
JMFS072H02+ CATGTCAAGAACAAAATGATCTGGATTTACATCCAAGAACAGTGGAGGAACCATGCTGAC
JMFS059D04+ CATGTCAAGAACAAAATGATCTGGATTTACATCCAAGAACAGTGGAGGAACCATGCTGAC
JMSF025E22+ CATATCAAGAACAAAATGATCTGGACGTACATCAAGGAACAGTGGAGGCACCATGCTAAC
JMSF028L10+ CATATCAAGAACAAAATGATCTGGACGTACATCAAGGAACAGTGGAGGCACCATGCTAAC
                      ____________________________________________________________
consensus CATGTCAAGAACAAAATGATCTGGATTTACATCCAGGAACAGTGGAGGCACCATGCTGAC
 
. : . : . : . : . : . :
JMFS072H02+ AGCCTCCTGCCTTGTAATGTTGCCAATTTCATTCTGCAGTTTCAAGAACTCGTGAAACCT
JMFS059D04+ AGCCTCCTGCCTTGTAATGTTGCCAATTTCATTCTGCAGTTTCAAGAACTCGTGAAACCT
JMFS166C04+ AGCTTCCTGTCTTGTAATGTTGCCAATTTCATTTTGTAGTTTCAAGAACTCATGGAACCT
JMSF025E22+ AGCTTCCTGTCTTGTAATGTTGCCAATTTCATTTTGTAGTTTCAAGAACTCATGGAACCT
JMSF028L10+ AGCTTCCTGTCTTGTAATGTTGCCAATTTCATTTTGTAGTTTCAAGAACTCATGGAACCT
                      ____________________________________________________________
consensus AGCTTCCTGTCTTGTAATGTTGCCAATTTCATTTTGTAGTTTCAAGAACTCATGGAACCT
 
. : . : . : . : . : . :
JMFS072H02+ CTCCAGTGTTTGGTTTTTTCGCAACTGGTTCCGAGAAAAATTGGATTGCCAAGCAAGGTT
JMFS059D04+ CTCCAGTGTTTGGTTTTTTCGCAACTGGTTCCGAGAAAAATTGGATTGCCAAGCAAGGTT
JMFS166C04+ CTCAAGCGTCTGGTTCTTTCTCAACTGTTTCCGAGAAAAATTGGAATGCCAAGCAAGGTT
JMSF025E22+ CTCAAGCGTCTGGTTCTTTCTCAACTGTTTCCGAGAAAAATTGGAATGCCAAGCAAGGTT
JMSF028L10+ CTCAAGCGTCTGGTTCTTTCTCAACTGTTTCCGAGAAAAATTGGAATGCCAAGCAAGGTT
                      ____________________________________________________________
consensus CTCAAGCGTCTGGTTCTTTCTCAACTGTTTCCGAGAAAAATTGGAATGCCAAGCAAGGTT
 
. : . : . : . : . : . :
JMFS072H02+ CTCAGGATACCAAGGCAGCGGTCTGATTGCCTCCACTTCACTCCCATCTGTAATCTCCGC
JMFS059D04+ CTCAGGATACCAAGGCAGCGGTCTGATTGCCTCCACTTCACTCCCATCTGTAATCTCCGC
JMFS166C04+ CTCAGGGTACCAGGGCAGTGGTTTGATTGCCTCTACTTCACTCCCATCTGCACCCTCTGC
JMSF025E22+ CTCAGGGTACCAGGGCAGTGGTTTGATTGCCTCTACTTCACTCCCATCTGCACCCTCTGC
JMSF028L10+ CTCAGGGTACCAGGGCAGTGGTTTGATTGCCTCTACTTCACTCCCATCTGCACCCTCTGC
                      ____________________________________________________________
consensus CTCAGGGTACCAGGGCAGTGGTTTGATTGCCTCTACTTCACTCCCATCTGCACCCTCTGC
 
. : . : . : . : . : . :
JMFS072H02+ CTGCAGGGACTTCACAAAATCATTCTCTAACTTTGATCTGATATCCATATAGATCTGGCT
JMFS059D04+ CTGCAGGGACTTCACAAAATCATTCTCTAACTTTGATCTGATATCCATATAGATCTGGCT
JMFS166C04+ CTGAAGAGAATTCATAAAATCACCCTCCAACTTTGAACGAATATCCATGTAGCACTGGCT
JMSF025E22+ CTGAAGAGAATTCATAAAATCACCCTCCAACTTTGAACGAATATCCATGTAGCACTGGCT
JMSF028L10+ CTGAAGAGAATTCATAAAATCACCCTCCAACTTTGAACGAATATCCATGTAGCACTGGCT
                      ____________________________________________________________
consensus CTGAAGAGAATTCATAAAATCACCCTCCAACTTTGAACGAATATCCATGTAGCACTGGCT
 
. : . : . : . : . : . :
JMFS072H02+ ACTGGAATTGATTCGAAATGCAGCAGGCAATGGACTCCGGAGATATTCATTGAACCTGTC
JMFS059D04+ ACTGGAATTGATTCGAAATGCAGCAGGCAATGGACTCCGGAGATATTCATTGAACCTGTC
JMFS166C04+ ACTGGAATTGATTCTGAAAGCAGCAGGGAGCGGAGTCCGGAGATAATCCATAAAAGTGTC
JMSF025E22+ ACTGGAATTGATTCTGAAAGCAGCAGGGAGCGGAGTCCGGAGATAATCCATAAAAGTGTC
JMSF028L10+ ACTGGAATTGATTCTGAAAGCAGCAGGGAGCGGAGTCCGGAGATAATCCATAAAAGTGTC
                      ____________________________________________________________
consensus ACTGGAATTGATTCTGAAAGCAGCAGGGAGCGGAGTCCGGAGATAATCCATAAAAGTGTC
 
. : . : . : . : . : . :
JMFS072H02+ CCACTCTTCCGGCGGAACTATTCCTTGTTCCTTGTAATA
JMFS059D04+ CCACTCTTCCGGCGGAACTATTCCTTGTTCCTTGTAATA
JMFS166C04+ CCACTCTTCCGGCGGCACTATTCCTTGCTCCTTGTAATATTCTTCAAACGAAGGATTACG
JMSF025E22+ CCACTCTTCCGGCGGCACTATTCCTTGCTCCTTGTAATATTCTTCAAACGAAGGATTACG
JMSF028L10+ CCACTCTTCCGGCGGCACTATTCCTTGCTCCTTGTAATATTCTTCAAACGAAGGATTACG
                      ____________________________________________________________
consensus CCACTCTTCCGGCGGCACTATTCCTTGCTCCTTGTAATATTCTTCAAACGAAGGATTACG
 
. : . : . : . : . : . :
JMFS166C04+ GGTGGCGAAAGGCTCCCGGGTGGGATTGCTATTGTTGGAGTTGTCGTTAGCATCATCATC
JMSF025E22+ GGTGGCGAAAGGCTCCCGGGTGGGATTGCTATTGTTGGAGTTGTCGTTAGCATCATCATC
JMSF028L10+ GGTGGCGAAAGGCTCCCGGGTGGGATTGCTATTGTTGGAGTTGTCGTTAGCATCATCATC
                      ____________________________________________________________
consensus GGTGGCGAAAGGCTCCCGGGTGGGATTGCTATTGTTGGAGTTGTCGTTAGCATCATCATC
 
. : . : . : . : . : . :
JMFS166C04+ CGCAGAGGTAGAGTTGTCCGCCGCCGGCGGTTGCTGAGAATCGAATTTTCGCCGTTTCCA
JMSF025E22+ CGCAGAGGTAGAGTTGTCCGCCGCCGGCGGTTGCTGAGAATCGAATTTTCGCCGTTTCCA
JMSF028L10+ CGCAGAGGTAGAGTTGTCCGCCGCCGGCGGTTGCTGAGAATCGAATTTTCGCCGTTTCCA
                      ____________________________________________________________
consensus CGCAGAGGTAGAGTTGTCCGCCGCCGGCGGTTGCTGAGAATCGAATTTTCGCCGTTTCCA
 
. : . : . : . : . : . :
JMFS166C04+ GACGTCATCTCTAGGCTGCCGGAAGTGTTTTCTCTGCGTGCGAGATCGACCTCCACCTCC
JMSF025E22+ GACGTCATCTCTAGGCTGCCGGAAGTGTTTTCTCTGCGTGCGAGATCGACCTCCACCTCC
JMSF028L10+ GACGTCATCTCTAGGCTGCCGGAAGTGTTTTCTCTGCGTGCGAGATCGACCTCCACCTCC
                      ____________________________________________________________
consensus GACGTCATCTCTAGGCTGCCGGAAGTGTTTTCTCTGCGTGCGAGATCGACCTCCACCTCC
 
. : . : . : . : . : . :
JMFS166C04+ CATTCTTCCT
JMSF025E22+ CATTCTTCCTCTTCACTCTTGAGGTTGCT
JMSF028L10+ CATTCTTCCTCTTCACTCTTGAGGTTGCTGCTTGCTTAACTGCCTTCCCTTCAGAAAACC
                      ____________________________________________________________
consensus CATTCTTCCTCTTCACTCTTGAGGTTGCTGCTTGCTTAACTGCCTTCCCTTCAGAAAACC