Previous Contig 006538:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028K01Sequence661006538 (2)gb:AB010077_15110281e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYH19.
JMSF036O20Sequence644006538 (2)gb:AB010077_15110286e-53Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYH19.753023737gb:AB010077_15110288e-92Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYH19.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028K01+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMSF036O20+ CTGAAGCCAAGATAGAGCATCGTCAAACAGGCCCTCTTTCCCAAACTGGGTGATCAGAG
JMSF028K01+ TCTGAAGCCAAGATAGAGCATCGTCAAACAGGCCNTCTTTCCCAAACTGGGTGATCAGAG
                      ____________________________________________________________
consensus TCTGAAGCCAAGATAGAGCATCGTCAAACAGGCCCTCTTTCCCAAACTGGGTGATCAGAG
 
. : . : . : . : . : . :
JMSF036O20+ TGGAGTAAGTGTACTTATCGGGTGACAGCCCCCGTTGGCGCATTTCGTCGAACAGCCCAT
JMSF028K01+ TGGAGTAAGTGTACTTATCGGGTGACAGCCCCCGTTGGCGCATTTCGTCGAACAGCCCAT
                      ____________________________________________________________
consensus TGGAGTAAGTGTACTTATCGGGTGACAGCCCCCGTTGGCGCATTTCGTCGAACAGCCCAT
 
. : . : . : . : . : . :
JMSF036O20+ AGGCGAGCTGCCATTGCTTCGCCCGGAGCACGTTACGCAGCACGACGTTGTACGCAAACA
JMSF028K01+ AGGCGAGCTGCCATTGCTTCGCCCGGAGCACGTTACGCAGCACGACGTTGTACGCAAACA
                      ____________________________________________________________
consensus AGGCGAGCTGCCATTGCTTCGCCCGGAGCACGTTACGCAGCACGACGTTGTACGCAAACA
 
. : . : . : . : . : . :
JMSF036O20+ CGGAGGGAGTGTACAGAGCCTCTTCATTGATCCAATCGAGCAGCGCAAGCGAGCGTTGCC
JMSF028K01+ CGGAGGGAGTGTACAGAGCCTCTTCATTGATCCAATCGAGCAGCGCAAGCGAGCGTTGCC
                      ____________________________________________________________
consensus CGGAGGGAGTGTACAGAGCCTCTTCATTGATCCAATCGAGCAGCGCAAGCGAGCGTTGCC
 
. : . : . : . : . : . :
JMSF036O20+ AGTCGGCTTCGCGCGAGAGGAGGGTGACCATGAACTTCATCGAAAGTGTTCGACCTTTGT
JMSF028K01+ AGTCGGCTTCGCGCGAGAGGAGGGTGACCATGAACTTCATCGAAAGTGTTCGACCTTTGT
                      ____________________________________________________________
consensus AGTCGGCTTCGCGCGAGAGGAGGGTGACCATGAACTTCATCGAAAGTGTTCGACCTTTGT
 
. : . : . : . : . : . :
JMSF036O20+ ACGGCGACATCAAAGCGAAAAGCTCATGCTCGTTGCTTGCCTTGCTTATTGACAGTAGCA
JMSF028K01+ ACGGCGACATCAAAGCGAAAAGCTCATGCTCGTTGCTTGTCTTGCTTATTGACAGTAGCA
                      ____________________________________________________________
consensus ACGGCGACATCAAAGCGAAAAGCTCATGCTCGTTGCTTGTCTTGCTTATTGACAGTAGCA
 
. : . : . : . : . : . :
JMSF036O20+ GCTCCTCCATGTCGACGCTGCTGTCCAAGAACGCCGGCAGCTGTTTCCGGCGGTACGGTG
JMSF028K01+ GCTCCTCCATGTCGACGCTGCTGTCCAAGAACGCCGGCAGCTGTTTCCGGCGGTACGGTG
                      ____________________________________________________________
consensus GCTCCTCCATGTCGACGCTGCTGTCCAAGAACGCCGGCAGCTGTTTCCGGCGGTACGGTG
 
. : . : . : . : . : . :
JMSF036O20+ TGGTTCTTGGTGACGACGACGGCGGCGGCGGCGGCTCAGCCGTCCTCCTCCAGGCATCTT
JMSF028K01+ TGGTTCTTGGTGACGACGACGGCGGCGGCGGCGGCTCAGCCGTCCTCCTCCAGGCATCTT
                      ____________________________________________________________
consensus TGGTTCTTGGTGACGACGACGGCGGCGGCGGCGGCTCAGCCGTCCTCCTCCAGGCATCTT
 
. : . : . : . : . : . :
JMSF036O20+ TTGACGAAGAAGTAGCGGAGATCGCCAATACGATGAAGTGGGTCCGAAGTTTCGCGGATT
JMSF028K01+ TTGACGAAGAAGTAGCGGAGATCGCCAATACGATGAAGTGGGTCCGAAATTTCGCGGATT
                      ____________________________________________________________
consensus TTGACGAAGAAGTAGCGGAGATCGCCAATACGATGAAGTGGGTCCGAAGTTTCGCGGATT
 
. : . : . : . : . : . :
JMSF036O20+ TCTTACCAAGCACGGCGATTCCGGCACGGTTGTGTGGCAATGGTGAAGGTGTAATGGAGC
JMSF028K01+ TCTTACCAAGCACGGCGATTCCGGCACGGTTGTGTGGCAATGGTGAAGGTGTAATGGAGC
                      ____________________________________________________________
consensus TCTTACCAAGCACGGCGATTCCGGCACGGTTGTGTGGCAATGGTGAAGGTGTAATGGAGC
 
. : . : . : . : . : . :
JMSF036O20+ ATACGTGTATGGAAATCGCGACAGAAAGCATTTCAAATCTTG
JMSF028K01+ ATACGTGTATGGAAATCGCGACAGAAAGCATTTCAAATCTTGTCTCCTCTGCTTTCGCCC
                      ____________________________________________________________
consensus ATACGTGTATGGAAATCGCGACAGAAAGCATTTCAAATCTTGTCTCCTCTGCTTTCGCCC