Previous Contig 006533:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015A06Sequence372006533 (3)sp|P93530|C7D6_SOLCH1e-13Cytochrome P450 71D6 (EC 1.14.-.-).>pir|T10493|T10493 probable cytochrome P450 (769012613 (3)gb:STU296346_17230326e-68Solanum tuberosum mRNA for cytochrome P450 (CYP71D4 gene).
JMSF015P24Sequence277006533 (3)sp|O81971|C7D9_SOYBN1e-06Cytochrome P450 71D9 (EC 1.14.-.-) (P450 CP3).>pir|T07117|T07117 probable cytoch747012613 (3)gb:STU296346_17230322e-60Solanum tuberosum mRNA for cytochrome P450 (CYP71D4 gene).
JMSF028I23Sequence650006533 (3)sp|P93530|C7D6_SOLCH2e-42Cytochrome P450 71D6 (EC 1.14.-.-).>pir|T10493|T10493 probable cytochrome P450 (746012613 (3)gb:STU296346_17230327e-55Solanum tuberosum mRNA for cytochrome P450 (CYP71D4 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028I23+ CTACTCACCATGATCAATATTTCGTTCACAAACTTAACCAACTCTTCCGT
                      ____________________________________________________________
consensus CTACTCACCATGATCAATATTTCGTTCACAAACTTAACCAACTCTTCCGT
 
. : . : . : . : . : . :
JMSF028I23+ CCTGTTCAGTGTCTTACCAAATGCAGCTCTACAAATGATGGAGGTCATAAATGTGGTGAC
                      ____________________________________________________________
consensus CCTGTTCAGTGTCTTACCAAATGCAGCTCTACAAATGATGGAGGTCATAAATGTGGTGAC
 
. : . : . : . : . : . :
JMSF028I23+ TTCATCAACTATATTGATTGGCCTGCCAGCGCCGGATGATGAACGGACACGATCCAATAG
                      ____________________________________________________________
consensus TTCATCAACTATATTGATTGGCCTGCCAGCGCCGGATGATGAACGGACACGATCCAATAG
 
. : . : . : . : . : . :
JMSF028I23+ ACGATGGCTCTCATCTTGCCTGATGTAGCTGAAGGAACGTACGGTTCTGGCACTGAGGAG
                      ____________________________________________________________
consensus ACGATGGCTCTCATCTTGCCTGATGTAGCTGAAGGAACGTACGGTTCTGGCACTGAGGAG
 
. : . : . : . : . : . :
JMSF015A06+ AGGACTAAAAAGGAT
JMSF028I23+ TTCCGTAATGCAAACTTTACGCATTTGCCTCCAGTATTCACCGTAAGGACTAAAAAGGAT
                      ____________________________________________________________
consensus TTCCGTAATGCAAACTTTACGCATTTGCCTCCAGTATTCACCGTAAGGACTAAAAAGGAT
 
. : . : . : . : . : . :
JMSF015A06+ GTCAGAGCTATCGTACATGACCTCGTCGCAGGCAAGAACTCTGGGTCTAGTGGCGAAGTC
JMSF015P24+ CGAAGTC
JMSF028I23+ GTCAGAGCTATCGTACATGACCTCGTCGGCGGCAAGAACTCTGGGTCTACTGGCGAAGTC
                      ____________________________________________________________
consensus GTCAGAGCTATCGTACATGACCTCGTCGGCGGCAAGAACTCTGGGTCTAGTGGCGAAGTC
 
. : . : . : . : . : . :
JMSF015A06+ GAGGTCGTGAGTTTTGAGGAACAGTTTGGCTACCTCGGCTGACGACACCACCACAGCAGG
JMSF015P24+ GAGATCGTGAGTTTTGAGGAACAGTTNGGCTACCTCGGCTGACGAGACCACCACAACAGA
JMSF028I23+ GAGATCGTGAGTTTTGAGGAACAGTTTGGCTACCTCGGCTGACGAGACCACCACAACAGA
                      ____________________________________________________________
consensus GAGATCGTGAGTTTTGAGGAACAGTTTGGCTACCTCGGCTGACGAGACCACCACAACAGA
 
. : . : . : . : . : . :
JMSF015A06+ AACTTCTCCGAGTTGAAGGTGCATCAGGTCCTTGCCGTACTGTTTGGACAAGTCCCTAAA
JMSF015P24+ AACTTCTCCGAGTTGAAGGTGCATCAGGTCCTTGCCGTACTGTTTGGACAAGTCTCTAAG
JMSF028I23+ AACTTCTCCGAGTTGAAGGTGCATCAGGTCCTTGCCGTACTGTTTGGACAAGTCTCTAAG
                      ____________________________________________________________
consensus AACTTCTCCGAGTTGAAGGTGCATCAGGTCCTTGCCGTACTGTTTGGACAAGTCTCTAAG
 
. : . : . : . : . : . :
JMSF015A06+ GGTAACGTGTGGGAGTTTTGCGCCTACTAAACGGTGCATGTCTCCGATGAGTGGCAGCTT
JMSF015P24+ GGTAACGTGTGGGAGTTTTGCGCCTACTAAATGGTGCATGTTTCCGATGAGTGGCAGCTT
JMSF028I23+ GGTAACGTGTGGGAGTTTTGCGCCTACTAAATGGTGCATGTTTCCGATGAGTGGCAGCTT
                      ____________________________________________________________
consensus GGTAACGTGTGGGAGTTTTGCGCCTACTAAATGGTGCATGTTTCCGATGAGTGGCAGCTT
 
. : . : . : . : . : . :
JMSF015A06+ CCTCGGTCCGGGAGGCAACTTCCGGCCGCTTTTCCGCTTCATCCATTGTCTAAGGACAAA
JMSF015P24+ CCTCGGTCCGGGAGGTAACTTCCGGCCGCTTTTCGGCTTCATCCATTGTCTAAGGACAAA
JMSF028I23+ CCTCGGTCCGGGAGGTAACTTCCGGCCGCTTTTCGGCTTCATCCATTGTCTAAGGACAAA
                      ____________________________________________________________
consensus CCTCGGTCCGGGAGGTAACTTCCGGCCGCTTTTCGGCTTCATCCATTGTCTAAGGACAAA
 
. : . : . : . : . : . :
JMSF015A06+ ACTAATGAAGGAAAGAAAGAGGCAGAAAGAAATGAGGTTCACCATTA
JMSF015P24+ ACT
JMSF028I23+ ACTGATGAAGGAAAGAAAGAGGCAGAAAGAAATGAGGTTCACCATTATACTATAGCAGTC
                      ____________________________________________________________
consensus ACTGATGAAGGAAAGAAAGAGGCAGAAAGAAATGAGGTTCACCATTATACTATAGCAGTC