Previous Contig 006531:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001N12Sequence278006531 (2)745021996gb:AP004153_18382745e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF028H23Sequence627006531 (2)gb:TOMDHQS_17256450.032Lycopersicon esculentum dehydroquinate synthase mRNA, complete cds.683023329gb:SOPRTKINB_17158422e-35S.oleracea mRNA for protein kinase.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001N12- GGGACGAAATTAGAAAGAGAAAATCTGA
                      ____________________________________________________________
consensus GGGACGAAATTAGAAAGAGAAAATCTGA
 
. : . : . : . : . : . :
JMSF001N12- GTAGTCTAGAACGGAAGGGGCGGCTCTCTATTGCTTCACGCGGCATTAAGTTTCTCCATC
                      ____________________________________________________________
consensus GTAGTCTAGAACGGAAGGGGCGGCTCTCTATTGCTTCACGCGGCATTAAGTTTCTCCATC
 
. : . : . : . : . : . :
JMSF001N12- AGCGTGAGTTCCAGCTCCTCATCACCTTCAACCTTCCGCAGCTACGCAATCTACGCTCCT
JMSF028H23+ AGCGTGAGTTCCAGCTCCTCATCATCTTCAACCTTCTGCAGCTACGCAATCTGCGCTTCT
                      ____________________________________________________________
consensus AGCGTGAGTTCCAGCTCCTCATCATCTTCAACCTTCTGCAGCTACGCAATCTGCGCTTCT
 
. : . : . : . : . : . :
JMSF001N12- ACATCTCAAGATTCAAGCTCTTCCGTGCC
JMSF028H23+ ACATCTCAAGATTCAAGCTCTTCCGTGCCACTCTGTCTCTCCCTCCGCACTCCGGCAGTC
                      ____________________________________________________________
consensus ACATCTCAAGATTCAAGCTCTTCCGTGCCACTCTGTCTCTCCCTCCGCACTCCGGCAGTC
 
. : . : . : . : . : . :
JMSF028H23+ CGCCCTCGTCAGTCGTCTCTCGTCTCTCACCGCCTCACGCCCTTCGCCCTTGCTCGGTCG
                      ____________________________________________________________
consensus CGCCCTCGTCAGTCGTCTCTCGTCTCTCACCGCCTCACGCCCTTCGCCCTTGCTCGGTCG
 
. : . : . : . : . : . :
JMSF028H23+ CTCCTCACATCCTCAGACGGTCAGCGACTCACCGGCGACCGTACGGGACTCAGCGACTGC
                      ____________________________________________________________
consensus CTCCTCACATCCTCAGACGGTCAGCGACTCACCGGCGACCGTACGGGACTCAGCGACTGC
 
. : . : . : . : . : . :
JMSF028H23+ AACTCCACTCCCTCAAGGTAAATTTTTACATATTAAAATTAAAATGAATTTCATACATTA
                      ____________________________________________________________
consensus AACTCCACTCCCTCAAGGTAAATTTTTACATATTAAAATTAAAATGAATTTCATACATTA
 
. : . : . : . : . : . :
JMSF028H23+ TATATGCTGGATTTTATGCGAATATATGGATCTGGCCAGCAGTCACCTTCCACTAAAAGC
                      ____________________________________________________________
consensus TATATGCTGGATTTTATGCGAATATATGGATCTGGCCAGCAGTCACCTTCCACTAAAAGC
 
. : . : . : . : . : . :
JMSF028H23+ TTCAGGTTCCAGCGGAGCTTGCAAACACCTTTAGTCGGTTGGGAGCATTAGAGTCCAAAC
                      ____________________________________________________________
consensus TTCAGGTTCCAGCGGAGCTTGCAAACACCTTTAGTCGGTTGGGAGCATTAGAGTCCAAAC
 
. : . : . : . : . : . :
JMSF028H23+ GGCACCGAGAAGGAAGAGTAGCAGAGGCAGGGAGGCGCACGACGAAGTCACGTAGGGTGG
                      ____________________________________________________________
consensus GGCACCGAGAAGGAAGAGTAGCAGAGGCAGGGAGGCGCACGACGAAGTCACGTAGGGTGG
 
. : . : . : . : . : . :
JMSF028H23+ CTTTGCGGTGGGAGTGTGGGGAGAAGGCGGGATTGGGTGGGCAGAAACAGGAAGACGCCC
                      ____________________________________________________________
consensus CTTTGCGGTGGGAGTGTGGGGAGAAGGCGGGATTGGGTGGGCAGAAACAGGAAGACGCCC