Previous Contig 006527:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028G24Sequence620006527 (7)gb:AF249743_17807842e-98Nicotiana tabacum heterotrimeric GTP-binding protein subunit beta 1 mRNA, comple694006527 (7)gb:AF414114_17976032e-87Solanum tuberosum G protein beta subunit 2 (GB2) mRNA, complete cds.
JMSF028H01Sequence658006527 (7)gb:AF249743_17807846e-81Nicotiana tabacum heterotrimeric GTP-binding protein subunit beta 1 mRNA, comple210012604 (3)
JMSF038P09Sequence661006527 (7)gb:AF249743_17807842e-81Nicotiana tabacum heterotrimeric GTP-binding protein subunit beta 1 mRNA, comple891006527 (7)gb:AF170921_1774379e-116Pisum sativum G protein beta subunit mRNA, complete cds.
JMSF039J23Sequence681006527 (7)gb:AF249743_17807847e-99Nicotiana tabacum heterotrimeric GTP-binding protein subunit beta 1 mRNA, comple178012604 (3)
JMSF040J23Sequence641006527 (7)gb:AF249743_17807847e-91Nicotiana tabacum heterotrimeric GTP-binding protein subunit beta 1 mRNA, comple225023907gb:AP003713_18323606e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P052

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028G24- CAGCAAGAAACATAAAGTAAATGATGGATGATTCC
rJMSF038P09- GCCTATGTTCACAGCAAGAAACATAAAGTAAATGATGGATGATTCC
                      ____________________________________________________________
consensus GCCTATGTTCACAGCAAGAAACATAAAGTAAATGATGGATGATTCC
 
. : . : . : . : . : . :
rJMSF028G24- TCAGGCAACGCTTTCACTAGGATACAGAAATCTACAAAAGGTAGCTCGATAGATGCATCA
rJMSF038P09- TCAGGCAACGCTTTCACTAGGATACAGAAATCTACAAAAGGTAGCTCGATAGATGCATCA
                      ____________________________________________________________
consensus TCAGGCAACGCTTTCACTAGGATACAGAAATCTACAAAAGGTAGCTCGATAGATGCATCA
 
. : . : . : . : . : . :
rJMSF028G24- CTTGCCCATCTTTAAAGGAAGCCGTAGGAGAAGAAGAATAAGAAACCATCCACTACTCAG
rJMSF038P09- CTTGCCCATCTTTAAAGGAAGCCGTAGGAGAAGAAGAATAAGAAACCATCCACTACTCAG
                      ____________________________________________________________
consensus CTTGCCCATCTTTAAAGGAAGCCGTAGGAGAAGAAGAATAAGAAACCATCCACTACTCAG
 
. : . : . : . : . : . :
rJMSF028G24- ATCACCTGCCTGTACCCTCCAAAAGCCCAAATCTTGAGGGTTGTGTCCCAACTCCCGGTG
rJMSF038P09- ATCACCTGCCTGTACCCTCCAAAAGCCCAAATCTTGAGGGTTGTGTCCCAACTCCCGGTG
                      ____________________________________________________________
consensus ATCACCTGCCTGTACCCTCCAAAAGCCCAAATCTTGAGGGTTGTGTCCCAACTCCCGGTG
 
. : . : . : . : . : . :
rJMSF028G24- CATAAGGCACTTCCATCCCCTGACAATCCCAAGCAACTGATCCGACCATCATGAGAGTTT
rJMSF038P09- CATAAGGCACTTCCATCCCCTGACAATCCCAAGCAACTGATCCGACCATCATGAGAGTTT
                      ____________________________________________________________
consensus CATAAGGCACTTCCATCCCCTGACAATCCCAAGCAACTGATCCGACCATCATGAGAGTTT
 
. : . : . : . : . : . :
rJMSF028G24- TGAAGTGATCCAAGATTTAGGACCATCTTAGCCAACAGAGTATCCCATACATAGCAATCA
rJMSF038P09- TGAAGTGATCCAAGATTTAGGACCATCTTAGCCAACAGAGTATCCCATACATAGCAATCA
                      ____________________________________________________________
consensus TGAAGTGATCCAAGATTTAGGACCATCTTAGCCAACAGAGTATCCCATACATAGCAATCA
 
. : . : . : . : . : . :
rJMSF028G24- CCATTTGTGTACCCAGCAAAGAGGAGACGACCAGAAATGGAGAATGCAATGGAAGTAACA
rJMSF038P09- CCATTTGTGTACCCAGCAAAGAGGAGACGACCAGAAATGGAGAATGCAATGGAAGTAACA
                      ____________________________________________________________
consensus CCATTTGTGTACCCAGCAAAGAGGAGACGACCAGAAATGGAGAATGCAATGGAAGTAACA
 
. : . : . : . : . : . :
rJMSF028G24- CGATGGACTTCATTATCACTATGGGGCTGAGAGTAAACTTGTAGCTGGTGCCCAGTCCTA
rJMSF038P09- CGATGGACTTCATTATCACTATGGGGCTGAGAGTAAACTTGTAGCTGGTGCCCAGTCCTA
                      ____________________________________________________________
consensus CGATGGACTTCATTATCACTATGGGGCTGAGAGTAAACTTGTAGCTGGTGCCCAGTCCTA
 
. : . : . : . : . : . :
rJMSF028G24- ATATCAAATAATCTGCAAGTTCCATCATCGGAGCCAGTTCCAAACCGATTTCCGTCAGGG
rJMSF038P09- ATATCAAATAATCTGCAAGTTCCATCATCGGAGCCAGTTCCAAACCGATTTCCGTCAGGG
                      ____________________________________________________________
consensus ATATCAAATAATCTGCAAGTTCCATCATCGGAGCCAGTTCCAAACCGATTTCCGTCAGGG
 
. : . : . : . : . : . :
rJMSF028G24- AAAAATTTTACAGCAATAACATCTCCCTCATGACCATGAAATGTACGAACTGCCCGACTA
rJMSF038P09- AAAAATTTTACAGCAATAACATCTCCCTCATGACCATGAAATGTACGAACTGCTCGACTA
                      ____________________________________________________________
consensus AAAAATTTTACAGCAATAACATCTCCCTCATGACCATGAAATGTACGAACTGCTCGACTA
 
. : . : . : . : . : . :
rJMSF028G24- GCAACACGGGTGTCCCACAGACAGGCAGTTGTGTCACAAGAACCAGAGACNAACATATTT
rJMSF038P09- GCAACACGGGTGTCCCACAGACAGGCAGTTGTGTCACAAGAACCAGAGACAAACATATTT
                      ____________________________________________________________
consensus GCAACACGGGTGTCCCACAGACAGGCAGTTGTGTCACAAGAACCAGAGACAAACATATTT
 
. : . : . : . : . : . :
rJMSF028G24- GTATTTGATGCACTAATTGACACGCTTGACACATCAGCAGTATGCCCAGACTGATATTC
rJMSF038P09- GTATTTGATGCACTAATTGACACGCTTGACACATCAGCAGTATGCCCAGACTGATATTCA
JMSF028G24+ CACATCAGCAGTATGCCCAGACTGATATTCA
JMSF040J23+ ACACATCAGCAGTATGCCCAGACTGATATTCA
JMSF039J23+ ACACATCAGCAGTATGCCCAGACTGATATTCA
                      ____________________________________________________________
consensus GTATTTGATGCACTAATTGACACGCTTGACACATCAGCAGTATGCCCAGACTGATATTCA
 
. : . : . : . : . : . :
rJMSF038P09- CCACCAAAAACAGAAGTTCTCAGACCAGTAGTTATATCCCACAAACCACATGTTTTATCA
JMSF028G24+ CCACCAAAAACAGAAGTTCTCAGACCAGTAGTTATATCCCACAAACCACATGTTTTATCA
JMSF040J23+ CCACCAAAAACAGAAGTTCTCAGACCAGTAGTTATATCCCACAAACCACATGTTTTATCA
JMSF039J23+ CCACCAAAAACAGAAGTTCTCAGACCAGTAGTTATATCCCACAAACCACATGTTTTATCA
JMSF038P09+ ATCA
                      ____________________________________________________________
consensus CCACCAAAAACAGAAGTTCTCAGACCAGTAGTTATATCCCACAAACCACATGTTTTATCA
 
. : . : . : . : . : . :
rJMSF038P09- CCAGAACTTGTTATTAAGTGAGCATCCTCATTAGGAACATACTGGCATGCGGATACATAA
JMSF028G24+ CCAGAACTTGTTATTAAGTGAGCATCCTCATTAGGAACATACTGGCATGCGGATACATAA
JMSF040J23+ CCAGAACTTGTTATTAAGTGAGCATCCTCATTAGGAACATANTGGCATGCGGATACATAA
JMSF039J23+ CCAGAACTTGTTATTAAGTGAGCATCCTCATTAGGAACATACTGGCATGCGGATACATAA
JMSF038P09+ CCAGAACTTGTTATTAAGTGAGCATCCTCATTAGGAACATACTGGCATGCGGATACATAA
JMSF028H01+ CCAGAACTTGTTATTAAGTGAGCATCCTCATTAGGAACATACTGGCATGCGGATACATAA
                      ____________________________________________________________
consensus CCAGAACTTGTTATTAAGTGAGCATCCTCATTAGGAACATACTGGCATGCGGATACATAA
 
. : . : . : . : . : . :
rJMSF038P09- CCCTTATGCCCACTTAGTGTTCTTGATACTGTTGAATTTCCCATCATTATCTGGAGGGAG
JMSF028G24+ CCCTTATGCCCACTTAGTGTTCTTGATACTGTTGAATTT-CCATCATTATCTGGAGGGAG
JMSF040J23+ CCCTTATGCCCACTTAGTGTTCTTGATACTGTTGAATTT-CCATCATTATCTGGAGGGAG
JMSF039J23+ CCCTTATGCCCACTTAGTGTTCTTGATACTGTTGAATTT-CCATCATTATCTGGAGGGAG
JMSF038P09+ CCCTTATGCCCACTTAGTGTTCTTGATACTGTTGAATTT-CCATCATTATCTGGAGGGAG
JMSF028H01+ CCCTTATGCCCACTTAGTGTTCTTGATACTGTTGAATTT-CCATCATTATCTGGAGGGAG
                      ____________________________________________________________
consensus CCCTTATGCCCACTTAGTGTTCTTGATACTGTTGAATTT-CCATCATTATCTGGAGGGAG
 
. : . : . : . : . : . :
rJMSF038P09- GT
JMSF028G24+ GTTCAAATTGAAAATAGAGCAAACACTATCAAGCCCTCCACAAGCAACAGACTGCCCAGT
JMSF040J23+ GTTCAAATTGAAAATAGAGCAAACACTATCAAGCCCTCCACAAGCAACAGACTGCCCAGT
JMSF039J23+ GTTCAAATTGAAAATAGAGCAAACACTATCAAGCCCTCCACAAGCAACAGACTGCCCAGT
JMSF038P09+ GTTCAAATTGAAAATAGAGCAAACACTATCAAGCCCTCCACAAGCAACAGACTGCCCAGT
JMSF028H01+ GTTCAAATTGAAAATAGAGCAAACACTATCAAGCCCTCCACAAGCAACAGACTGCCCAGT
                      ____________________________________________________________
consensus GTTCAAATTGAAAATAGAGCAAACACTATCAAGCCCTCCACAAGCAACAGACTGCCCAGT
 
. : . : . : . : . : . :
JMSF028G24+ TGGAGAGAAGGCACAGGTCATGACCCAAGCACATGGTAGCTTAATCGCATGAGTTTTCTG
JMSF040J23+ TGGAGAGAAGGCACAGGTCATGACCCAAGCACATGGTAGCTTAATCGCATGAGTTTTCTG
JMSF039J23+ TGGAGAGAAGGCACAGGTCATGACCCAAGCACATGGTAGCTTAATCGCATGAGTTTTCTG
JMSF038P09+ TGGAGAGGAGGCACAGGTCATGACCCAAGCACATGGTAGCTTAATCGCATGAGTTTTCTG
JMSF028H01+ TGGAGAGAAGGCACAGGTCATGACCCAAGCACATGGTAGCTTAATCGCATGAGTTTTCTG
                      ____________________________________________________________
consensus TGGAGAGAAGGCACAGGTCATGACCCAAGCACATGGTAGCTTAATCGCATGAGTTTTCTG
 
. : . : . : . : . : . :
JMSF028G24+ GCTTGTAAGAGCATTCCAAACAATTAACCTGCCATCTTGAGATGCACTGACAATGCGATT
JMSF040J23+ GCTTGTAAGAGCATTCCAAACAATTAACCTGCCATCNTGAGATGCACTGACAATGCGATT
JMSF039J23+ GCTTGTAAGAGCATTCCAAACAATTAACCTGCCATCTTGAGATGCACTGACAATGCGATT
JMSF038P09+ GCTTGTAAGAGCATTCCAAACAATTAACCTGCCATCTTGAGATGCACTGACAATGCGATT
JMSF028H01+ GCTTGTAAGAGCATTCCAAACAATTAACCTGCCATCTTGAGATGCACTGACAATGCGATT
                      ____________________________________________________________
consensus GCTTGTAAGAGCATTCCAAACAATTAACCTGCCATCTTGAGATGCACTGACAATGCGATT
 
. : . : . : . : . : . :
JMSF028G24+ TTTTTCAGGAGTCCAGTCCAGTGAATACACCTTGCCTGTGTGACCTTGCAAGTTTCTACA
JMSF040J23+ TTTTTCAGGAGTCCAGTCCAGTGAATACACCTTGCCTGTGTGACCTTGCAAGTTTNTACA
JMSF039J23+ TTTTTCAGGAGTCCAGTCCAGTGAATACACCTTGCCTGTGTGACCTTGCAAGTTTCTACA
JMSF038P09+ TTTTTCAGGAGTCCAGTCCAGTGAATACACCTTGCCTGTGTGACCTTGCAAGTTTCTACA
JMSF028H01+ TTTTTCAGGAGTCCAGTCCAGTGAATACACCTTGCCTGTGTGACCTTGCAAGTTTCTACA
                      ____________________________________________________________
consensus TTTTTCAGGAGTCCAGTCCAGTGAATACACCTTGCCTGTGTGACCTTGCAAGTTTCTACA
 
. : . : . : . : . : . :
JMSF028G24+ GCACACCAGATCTGTAGGGCCGAAGCTGATCGGAGTCTTACCTTGCGACCTTGCATACGT
JMSF040J23+ GCACACCAGATCTGTAGGGCCGAAGCTGATCGGAGTCTTACCTTGCGACCTTGCATACGT
JMSF039J23+ GCACACCAGATCTGTAGGGCCGAAGCTGATCGGAGTCTTACCTTGCGACCTTGCATACGT
JMSF038P09+ GCACACCAGATCTGTAGGGCCGAAGCTGATCGGAGTCTTACCTTGCGACCTTGCATACGT
JMSF028H01+ GCACACCAGATCTGTAGGGCCGAAGCTGATCGGAGTCTTACCTTGCGACCTTGCATACGT
                      ____________________________________________________________
consensus GCACACCAGATCTGTAGGGCCGAAGCTGATCGGAGTCTTACCTTGCGACCTTGCATACGT
 
. : . : . : . : . : . :
JMSF028G24+ CGCAACATCAGTGTCGAGAAGAAGAAGACGTTTCTCCTTCAATCGTTCCCGAAGAGAATT
JMSF040J23+ CGCAACATCAGTGTCGAGAAGAAGAAGACGTTTCTCCTTCAATCGTTCGCGAAGAGAATT
JMSF039J23+ CGCAACATCAGTGTCGAGAAGAAGAAGACGTTTCTCCTTCAATCGTTCGCGAAGAGAATT
JMSF038P09+ CGCAACATCAGTGTCGAGAAGAAGAAGACGTTTCTCCTTCAATCGTTCCCGAAGAGAATT
JMSF028H01+ CGCAACATCAGTGTCGAGAAGAAGAAGACGTTTCTCCTTCAATCGTTCCCGAAGAGAATT
                      ____________________________________________________________
consensus CGCAACATCAGTGTCGAGAAGAAGAAGACGTTTCTCCTTCAATCGTTCCCGAAGAGAATT
 
. : . : . : . : . : . :
JMSF028G24+ TACAGT-CTGGGTCGCTGCCATGTGCCTTTCTTTGAGCTCCGCTACTGAC
JMSF040J23+ TACAGTNATGGGTCGCTGCCATGTGCCTTTCTTTGAGCTCCGCTACTGACATTTTTGTTT
JMSF039J23+ TACAGT-CTGGGTCGCTGCCATGTGCCTTTCTTTGAGCTCCGCTACTGACATTTTTGTTT
JMSF038P09+ TACAGT-CTGGGTCGCTGCCATGTGCCTTTCTTTGAGCTCCGCTACTGACATTTTTGTTT
JMSF028H01+ TACAGT-CTGGGTCGCTGCCATGTGCCTTTCTTTGAGCTCCGCTACTGACATTTTTGTTT
                      ____________________________________________________________
consensus TACAGT-CTGGGTCGCTGCCATGTGCCTTTCTTTGAGCTCCGCTACTGACATTTTTGTTT
 
. : . : . : . : . : . :
JMSF040J23+ TTCCTT
JMSF039J23+ TTCCTT
JMSF038P09+ TTCCTTGGAAAATTCCGCTCTTAAATCATCTTAGTACGAATTTTGATAGTAAGACAAAGG
JMSF028H01+ TTCCTTGGAAAATTCCGCTCTTAAATCATCTTAGTACGAATTTTGATAGTAAGACAAAGG
                      ____________________________________________________________
consensus TTCCTTGGAAAATTCCGCTCTTAAATCATCTTAGTACGAATTTTGATAGTAAGACAAAGG
 
. : . : . : . : . : . :
JMSF038P09+ GATTAGTTTTAAAACTCCTGACAGAATTTTAGGGTTTAGAGTAGAACAATCTGAATCT
JMSF028H01+ GATTAGTTTTAAAACTCCTGACAGAATTTTAGGGTTTAGAGTAGAACAATCTGAATCTTC
                      ____________________________________________________________
consensus GATTAGTTTTAAAACTCCTGACAGAATTTTAGGGTTTAGAGTAGAACAATCTGAATCTTC