Previous Contig 006519:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN004O24Sequence474006519 (5)gb:AY048225_15616875e-27Arabidopsis thaliana AT5g19150/T24G5_50 mRNA, complete cds.>gb:AY101541_1577652
JMSF028F12Sequence653006519 (5)gb:AY048225_15616871e-59Arabidopsis thaliana AT5g19150/T24G5_50 mRNA, complete cds.>gb:AY101541_1577652 728006519 (5)gb:AY048225_15616871e-67Arabidopsis thaliana AT5g19150/T24G5_50 mRNA, complete cds.>gb:AY101541_1577652
JMSF036N14Sequence638006519 (5)gb:AY048225_15616875e-69Arabidopsis thaliana AT5g19150/T24G5_50 mRNA, complete cds.>gb:AY101541_1577652 715006519 (5)gb:AY048225_15616879e-58Arabidopsis thaliana AT5g19150/T24G5_50 mRNA, complete cds.>gb:AY101541_1577652

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN004O24+ GTGAGAACTGC
                      ____________________________________________________________
consensus GTGAGAACTGC
 
. : . : . : . : . : . :
JMFN004O24+ TTAACAATTCAAATTTTGTTGTAACATAGTGACTAGATAAAAGGTTTAACAATGATTATT
rJMSF028F12- TGACTAGATAAAAGGTTTAACAATGATTATT
                      ____________________________________________________________
consensus TTAACAATTCAAATTTTGTTGTAACATAGTGACTAGATAAAAGGTTTAACAATGATTATT
 
. : . : . : . : . : . :
JMFN004O24+ GCAACAAATATTTAGAATTTCTTTCCGCAATATGCCTTATTTTATTGATTGCTCTCATAT
rJMSF028F12- GCAACAAATATTTAGAATTTCTTTCCGCAATATGCCTTATTTTATTGATTGCTCTCATAT
rJMSF036N14- ACAAANATTTAGAATTTCTTTCCGCAATATGCCTTATTTTATTGATTGCTCTCANAT
                      ____________________________________________________________
consensus GCAACAAATATTTAGAATTTCTTTCCGCAATATGCCTTATTTTATTGATTGCTCTCATAT
 
. : . : . : . : . : . :
JMFN004O24+ TTAGTTTCACCAAACAGCTTCTTATTGAAGGCAGAAGTTACATTTACAACACCACAACTC
rJMSF028F12- TTAGTTTCACCAAACAGCTTCTTATTGAAGGCAGAAGTTACATTTACAACACCACAACTC
rJMSF036N14- TTAGTTTCGCCAAACAGCTTCTTATTGAAGGCAGAAGTTACATTTACAANNCCACAANTC
                      ____________________________________________________________
consensus TTAGTTTCACCAAACAGCTTCTTATTGAAGGCAGAAGTTACATTTACAACACCACAACTC
 
. : . : . : . : . : . :
JMFN004O24+ TACCAGATGACTTATTGAGTTTGTCTCTCAGAGGACTGGACATATCTCCTCCAAGCTTTG
rJMSF028F12- TACCAGATGACTTATTGAGTTTGTCTCTCAGAGGACTGGACATATCTCCTCCAAGCTTTG
rJMSF036N14- TACCAGATGACTTATTGAGTTTGTCTCTCAGAGGACTGGACATATCTCCTCCAAGCTTTG
                      ____________________________________________________________
consensus TACCAGATGACTTATTGAGTTTGTCTCTCAGAGGACTGGACATATCTCCTCCAAGCTTTG
 
. : . : . : . : . : . :
JMFN004O24+ TCCCAGGCACTCAATGATATCCCCAGTGAGTGTGGATCTCCTCTTGTTCTCGAATGCAAG
rJMSF028F12- TCCCAGGCACTCAATGATATCCCCAGTGAGTGTGGATCTCCTCTTGTTCTCGAATGCAAG
rJMSF036N14- TCCCAGGCNCTCAATGATATCCCCAGTGAGTGTGGATCTCCTCTTGTTCTCGNATGCAAG
                      ____________________________________________________________
consensus TCCCAGGCACTCAATGATATCCCCAGTGAGTGTGGATCTCCTCTTGTTCTCGAATGCAAG
 
. : . : . : . : . : . :
JMFN004O24+ GGCTGCCGCCTTTCTCAGTAGAGCAGAGCCAGCGATACACCCTAGTATTGTAGGATTAGT
rJMSF028F12- GGCTGCCGCCTTTCTCAGTAGAGCAGAGCCAGCGATACACCCTAGTATTGTAGGATTAGT
rJMSF036N14- GGCTGCCGCCTTTCTCAGTAGAGCAGANCCAGCGATACNCCCTAGTATTGTAGGATTANT
                      ____________________________________________________________
consensus GGCTGCCGCCTTTCTCAGTAGAGCAGAGCCAGCGATACACCCTAGTATTGTAGGATTAGT
 
. : . : . : . : . : . :
JMFN004O24+ GACCGATTCTCCCTTAGCAGCTTGCTGGCGTGCCCAACATAGAAATACAGCAACGCTTCC
rJMSF028F12- GACCGATTCTCCCTTAGCAGCTTGCTGGCGTGCCCAACATAGAAATACAGCAACGCTTCC
rJMSF036N14- GANCGATTCTCCCTTAGCAGCTTGCTGGCGTGNCCAACATAGAAATACAGCAACGCTTCC
JMSF036N14+ CATAGAAATACAGCAACGCTTCC
                      ____________________________________________________________
consensus GACCGATTCTCCCTTAGCAGCTTGCTGGCGTGCCCAACATAGAAATACAGCAACGCTTCC
 
. : . : . : . : . : . :
JMFN004O24+ TGAAAGTATATCACCCTGGCCACCACAGCGTCGAGGGGAGCCA
rJMSF028F12- TGAAAGTATATCACCCTGGCCACCACAGCGTCGAGGGGAGCCATATATGCTCACTGAACT
rJMSF036N14- TGAAAGTATATCACCCTGGCCACCACAGCGTCNAGGGGAGCCATATATGCTCACTGAACT
JMSF036N14+ TGAAAGTATATCACCCTGGCCACCACAGCGTCGAGGGGAGCCATATATGCTCACTGAACT
                      ____________________________________________________________
consensus TGAAAGTATATCACCCTGGCCACCACAGCGTCGAGGGGAGCCATATATGCTCACTGAACT
 
. : . : . : . : . : . :
rJMSF028F12- AACTGTTTCACCATCGCTGATTAAATCAGATTTTCCTTTCCGTAAAATTGTCACGCCACC
rJMSF036N14- AACTGTTTCACCATCGCTGATTAAATCAGATTTTCCTTTCCGTAAAANTGTCACGCCACC
JMSF036N14+ AACTGTTTCACCATCGCTGATTAAATCAGATTTTCCTTTCCGTAAAATTGTCACGCCACC
                      ____________________________________________________________
consensus AACTGTTTCACCATCGCTGATTAAATCAGATTTTCCTTTCCGTAAAATTGTCACGCCACC
 
. : . : . : . : . : . :
rJMSF028F12- AATCCCATTAACAAGGGATTTTAATTGTTCAGTTCCATTTTGATCATTAACTTCAGAATT
rJMSF036N14- NATCCCANTAACANGGGATTTTAATTGNTCAGTTCCATTTTGATCATTAACTTCAGAATT
JMSF036N14+ AATCCCATTAACAAGGGATTTTAATTGTTCAGTTCCATTTTGATCATTAACTTCAGAATT
                      ____________________________________________________________
consensus AATCCCATTAACAAGGGATTTTAATTGTTCAGTTCCATTTTGATCATTAACTTCAGAATT
 
. : . : . : . : . : . :
rJMSF028F12- TAGCACACTTTGAACAAGACGTTTATACTCATTTATGTTGGGTGTCAGCACAGCCAAAGG
rJMSF036N14- TAGCACACTTTGAACAAGACGTTTATACTCATTTATGTTGGGTGTCAGCACAGCCAAAGG
JMSF036N14+ TAGCACACTTTGAACAAGACGTTTATACTCATTTATGTTGGGTGTCAGCACAGCCAAAGG
                      ____________________________________________________________
consensus TAGCACACTTTGAACAAGACGTTTATACTCATTTATGTTGGGTGTCAGCACAGCCAAAGG
 
. : . : . : . : . : . :
rJMSF028F12- ATAGCCTCTAACCAGATCAAGACTATTTGTAACAAGAAAGAGTCCATCCCCATCTATAAC
rJMSF036N14- ATAGCCTCTAACCAGATCAAGACTATTTGTAACAAGAAAGAGTCCATCCCCATCTATAAC
JMSF036N14+ ATAGCCTCTAACCAGATCAAGACTATTTGTAACAAGAAAGAGTCCATCCCCATCTATAAC
                      ____________________________________________________________
consensus ATAGCCTCTAACCAGATCAAGACTATTTGTAACAAGAAAGAGTCCATCCCCATCTATAAC
 
. : . : . : . : . : . :
rJMSF028F12- CATTGGGGACACCACAATCTCGTGCATGCTTTATGAT
rJMSF036N14- CATT-GGGACACCACAATCTCGTGCATGCTTTATGATGTTACTCACGCAG
JMSF036N14+ CATT-GGGACACCACAATCTCGTGCATGCTTTATGATGTTACTCACGCAGTCCAGGAGAA
JMSF028F12+ GACACCACAATCTCGTGCATGCTTTATGATGTTACTCACGCAGTCCAGGAGAA
                      ____________________________________________________________
consensus CATT-GGGACACCACAATCTCGTGCATGCTTTATGATGTTACTCACGCAGTCCAGGAGAA
 
. : . : . : . : . : . :
JMSF036N14+ ATGGATCCCTTCCGAGACCTGGACCAATAACTAAGCAATCAAATCTCTCCATCCATTTAT
JMSF028F12+ ATGGATCCCTTCCGAGACCTGGACCAATAACTAAGCAATCAAATCTCTCCATCCATTTAT
                      ____________________________________________________________
consensus ATGGATCCCTTCCGAGACCTGGACCAATAACTAAGCAATCAAATCTCTCCATCCATTTAT
 
. : . : . : . : . : . :
JMSF036N14+ CAACCTCTGCAATCACTTTGGCTGATATAGAGCTTTTATCCTCATCCCT
JMSF028F12+ CAACCTCTGCAATCACTTTGGCTGATATAGAGCTTTTATCCTCATCCCTAATGCTGTAAG
                      ____________________________________________________________
consensus CAACCTCTGCAATCACTTTGGCTGATATAGAGCTTTTATCCTCATCCCTAATGCTGTAAG
 
. : . : . : . : . : . :
JMSF028F12+ ATTCTTCTAGAATAGGATGTACAATTAACTCAGGACTATAGCTTTTTATAACTGGAGCAG
                      ____________________________________________________________
consensus ATTCTTCTAGAATAGGATGTACAATTAACTCAGGACTATAGCTTTTTATAACTGGAGCAG
 
. : . : . : . : . : . :
JMSF028F12+ CATCTTTTGTGCAAAATACATGAGACAAATCTGCACCAATTTTCAATGCTGAAATAGCAG
                      ____________________________________________________________
consensus CATCTTTTGTGCAAAATACATGAGACAAATCTGCACCAATTTTCAATGCTGAAATAGCAG
 
. : . : . : . : . : . :
JMSF028F12+ AAAAGTATGGCGCCCCAGTGTACTCGCGACACCCACCTACAACAGCTATCTTACCAGCTT
                      ____________________________________________________________
consensus AAAAGTATGGCGCCCCAGTGTACTCGCGACACCCACCTACAACAGCTATCTTACCAGCTT
 
. : . : . : . : . : . :
JMSF028F12+ GGCCTTTGTGCTTAGTTGAGTCGAGATTTGGGGTTATTGATCGTAAAACGCTGACAGCAT
                      ____________________________________________________________
consensus GGCCTTTGTGCTTAGTTGAGTCGAGATTTGGGGTTATTGATCGTAAAACGCTGACAGCAT
 
. : . : . : . : . : . :
JMSF028F12+ CGACCTCCAATCTAGCCCCAATGCTCACTACAGACTGCATTCTAATAGTATTCTGATAGC
                      ____________________________________________________________
consensus CGACCTCCAATCTAGCCCCAATGCTCACTACAGACTGCATTCTAATAGTATTCTGATAGC
 
. : . : . : . : . : . :
JMSF028F12+ CACAATTCTTAGCTTTCCCAGCTAAACCCCCCAAACACCTTAGCAAGAACTGCAGCCTTC
                      ____________________________________________________________
consensus CACAATTCTTAGCTTTCCCAGCTAAACCCCCCAAACACCTTAGCAAGAACTGCAGCCTTC
 
. : . : . : . : . : . :
JMSF028F12+ TAGTTACAGCTGCTGAATTTGCCAGCGTTAAACTACTTCCAAATCAAAAGAGAATGCGGA
                      ____________________________________________________________
consensus TAGTTACAGCTGCTGAATTTGCCAGCGTTAAACTACTTCCAAATCAAAAGAGAATGCGGA
 
. : . : . : . : . : . :
JMSF028F12+ TTCCGGTGGCTGAAGAAAGAAAGATGTGAGCTTTTCTTAAGTTCAAACTTCAAAGCGGGC
                      ____________________________________________________________
consensus TTCCGGTGGCTGAAGAAAGAAAGATGTGAGCTTTTCTTAAGTTCAAACTTCAAAGCGGGC