Previous Contig 006506:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN009E24Sequence598006506 (4)gb:AB019226_15140641e-34Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K24M7.>gb:AY034962_155
JMFN032C07Sequence598006506 (4)gb:AB019226_15140641e-34Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K24M7.>gb:AY034962_155
JMSF028B21Sequence669006506 (4)gb:AB016885_15131252e-33Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19M22.>gb:AY054492_15621006506 (4)gb:AB016885_15131252e-33Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19M22.>gb:AY054492_15

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN032C07+ GGTACGCCTAATAAATTCATGGATAAAGACAGAACACA
JMFN009E24+ GGTACGCCTAATAAATTCATGGATAAAGACAGAACACA
JMSF028B21+ GAACACA
                      ____________________________________________________________
consensus GGTACGCCTAATAAATTCATGGATAAAGACAGAACACA
 
. : . : . : . : . : . :
JMFN032C07+ ATAAGTTTACATCTGATTGCTAAGAATTCCACTTGTGAGGCAGTACAATTATGTTGGAAA
JMFN009E24+ ATAAGTTTACATCTGATTGCTAAGAATTCCACTTGTGAGGCAGTACAATTATGTTGGAAA
rJMSF028B21- GCAGTACAATTATGTTGGAAA
JMSF028B21+ ATAAGTTTACATCTGATTGCTAAGAATTCCACTTGTGAGGCAGTACAATTATGTTGGAAA
                      ____________________________________________________________
consensus ATAAGTTTACATCTGATTGCTAAGAATTCCACTTGTGAGGCAGTACAATTATGTTGGAAA
 
. : . : . : . : . : . :
JMFN032C07+ ATAACACTAAAGGCACTGCCATCATCAAACACAGCATGTGTAACCATTCAACAAAATATG
JMFN009E24+ ATAACACTAAAGGCACTGCCATCATCAAACACAGCATGTGTAACCATTCAACAAAATATG
rJMSF028B21- ATAACACTAAAGGCACTGCCATCATCAAACACAGCATGTGTAACCATTCAACAAAATATG
JMSF028B21+ ATAACACTAAAGGCACTGCCATCATCAAACACAGCATGTGTAACCATTCAACAAAATATG
                      ____________________________________________________________
consensus ATAACACTAAAGGCACTGCCATCATCAAACACAGCATGTGTAACCATTCAACAAAATATG
 
. : . : . : . : . : . :
JMFN032C07+ AGAATTTTCAACTTTCAAGCTATGAGGAGTAATGCAGTTGGACCGTGATAATAAGAATGA
JMFN009E24+ AGAATTTTCAACTTTCAAGCTATGAGGAGTAATGCAGTTGGACCGTGATAATAAGAATGA
rJMSF028B21- AGAATTTTCAACTTTCAAGCTATGAGGAGTAATGCAGTTGGACCGTGATAATAAGAATGA
JMSF028B21+ AGAATTTTCAACTTTCAAGCTATGAGGAGTAATGCAGTTGGACCGTGATAATAAGAATGA
                      ____________________________________________________________
consensus AGAATTTTCAACTTTCAAGCTATGAGGAGTAATGCAGTTGGACCGTGATAATAAGAATGA
 
. : . : . : . : . : . :
JMFN032C07+ AATTATGCAGATTGAACCTCGAGCTTGGGGGTGTTCTCTTCGACTTTTTTTGAGTTTGGT
JMFN009E24+ AATTATGCAGATTGAACCTCGAGCTTGGGGGTGTTCTCTTCGACTTTTTTTGAGTTTGGT
rJMSF028B21- AATTATGCAGATTGAACCTCGAGCTTGGGGGTGTTCTCTTCGACTTTTTTTGAGTTTGGT
JMSF028B21+ AATTATGCAGATTGAACCTCGAGCTTGGGGGTGTTCTCTTCGACTTTTTTTGAGTTTGGT
                      ____________________________________________________________
consensus AATTATGCAGATTGAACCTCGAGCTTGGGGGTGTTCTCTTCGACTTTTTTTGAGTTTGGT
 
. : . : . : . : . : . :
JMFN032C07+ AGGTATCTCCAGCAGCGTTTGTTGACCCCACTAATTTTCTTGGGTGAGTCGGCAATTGGA
JMFN009E24+ AGGTATCTCCAGCAGCGTTTGTTGACCCCACTAATTTTCTTGGGTGAGTCGGCAATTGGA
rJMSF028B21- AGGTATCTCCAGCAGCGTTTGTTGACCCCACTAATTTTCTTGGGTGAGTCGGCAATTGGA
JMSF028B21+ AGGTATCTCCAGCAGCGTTTGTTGACCCCACTAATTTTCTTGGGTGAGTCGGCAATTGGA
                      ____________________________________________________________
consensus AGGTATCTCCAGCAGCGTTTGTTGACCCCACTAATTTTCTTGGGTGAGTCGGCAATTGGA
 
. : . : . : . : . : . :
JMFN032C07+ GTACCGTCTTTATGAGCGATGCCCCAAGCCTTTCCGTGCGTCCCACTCTTGTAGAGATTG
JMFN009E24+ GTACCGTCTTTATGAGCGATGCCCCAAGCCTTTCCGTGCGTCCCACTCTTGTAGAGATTG
rJMSF028B21- GTACCGTCTTTATGAGCGATGCCCCAAGCCTTTCCGTGCGTCCCACTCTTGTAGAGATTG
JMSF028B21+ GTACCGTCTTTATGAGCGATGCCCCAAGCCTTTCCGTGCGTCCCACTCTTGTAGAGATTG
                      ____________________________________________________________
consensus GTACCGTCTTTATGAGCGATGCCCCAAGCCTTTCCGTGCGTCCCACTCTTGTAGAGATTG
 
. : . : . : . : . : . :
JMFN032C07+ ATTTTGGTGATTTGGTAAGAAACGTCAGTCCAGTGGGTTTTAGCCATGTGATAGCCAATG
JMFN009E24+ ATTTTGGTGATTTGGTAAGAAACGTCAGTCCAGTGGGTTTTAGCCATGTGATAGCCAATG
rJMSF028B21- ATTTTGGTGATTTGGTAAGAAACGTCAGTCCAGTGGGTTTTAGCCATGTGATAGCCAATG
JMSF028B21+ ATTTTGGTGATTTGGTAAGAAACGTCAGTCCAGTGGGTTTTAGCCATGTGATAGCCAATG
                      ____________________________________________________________
consensus ATTTTGGTGATTTGGTAAGAAACGTCAGTCCAGTGGGTTTTAGCCATGTGATAGCCAATG
 
. : . : . : . : . : . :
JMFN032C07+ CCCCAGTTGGGGAGAAACTGCGCCACCTCGAAGAAGTTCTTCTTCTTCTTCCGCTTCGGC
JMFN009E24+ CCCCAGTTGGGGAGAAACTGCGCCACCTCGAAGAAGTTCTTCTTCTTCTTCCGCTTCGGC
rJMSF028B21- CCCCAGTTGGGGAGAAACTGCGCCACCTCGAAGAAGTTCTTCTTCTTCTTCCGCTTCGGC
JMSF028B21+ CCCCAGTTGGGGAGAAACTGCGCCACCTCGAAGAAGTTCTTCTTCTTCTTCCGCTTCGGC
                      ____________________________________________________________
consensus CCCCAGTTGGGGAGAAACTGCGCCACCTCGAAGAAGTTCTTCTTCTTCTTCCGCTTCGGC
 
. : . : . : . : . : . :
JMFN032C07+ TTCTTAACGCCGGCCGCCGCCGCCTCAGCCGGAGGATTGAGAGGAGTGGCTGAAGTGCTC
JMFN009E24+ TTCTTAACGCCGGCCGCCGCCGCCTCAGCCGGAGGATTGAGAGGAGTGGCTGAAGTGCTC
rJMSF028B21- TTCTTAACGCCGGCCGCCGCCGCCTCAGCCGGAGGATTGGGAGGAGTGGCTGAAGTGCTC
JMSF028B21+ TTCTTAACGCCGGCCGCCGCCGCCTCAGCCGGAGGATTGGGAGGAGTGGCTGAAGTGCTC
                      ____________________________________________________________
consensus TTCTTAACGCCGGCCGCCGCCGCCTCAGCCGGAGGATTGGGAGGAGTGGCTGAAGTGCTC
 
. : . : . : . : . : . :
JMFN032C07+ AGATTTCTCAGGAAGTTGAA
JMFN009E24+ AGATTTCTCAGGAAGTTGAA
rJMSF028B21- AGATTTCTCAGGAAGTTGAAGGAGAGTCTGAATAAACTGGCGGCTCGATCCGCCGATGGC
JMSF028B21+ AGATTTCTCAGGAAGTTGAAGGAGAGTCTGAATAAACTGGCGGCTCGATCCGCCGATGGC
                      ____________________________________________________________
consensus AGATTTCTCAGGAAGTTGAAGGAGAGTCTGAATAAACTGGCGGCTCGATCCGCCGATGGC
 
. : . : . : . : . : . :
rJMSF028B21- CTTGCTAGAGCAGTCGCCATTGTTTTCCAATCAGCCAACTGCAGAATCTGCTGCCCTTCC
JMSF028B21+ CTTGCTAGAGCAGTCGCCATTGTTTTCCAATCAGCCAACTGCAGAATCTGCTGCCCTTCC
                      ____________________________________________________________
consensus CTTGCTAGAGCAGTCGCCATTGTTTTCCAATCAGCCAACTGCAGAATCTGCTGCCCTTCC