Previous Contig 006504:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028A17Sequence636006504 (3)gb:AY075653_15677928e-89Arabidopsis thaliana At1g14000/F7A19_9 mRNA, complete cds.
JMSF039L04Sequence676006504 (3)gb:AY075653_1567792e-113Arabidopsis thaliana At1g14000/F7A19_9 mRNA, complete cds.898006504 (3)gb:AY075653_1567792e-117Arabidopsis thaliana At1g14000/F7A19_9 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039L04- AGTTTTGCAATT
                      ____________________________________________________________
consensus AGTTTTGCAATT
 
. : . : . : . : . : . :
rJMSF039L04- TGAAGAATACCACAGTAATTACATACAGGCAACACATTTTCCAAACTTGAATGGGCTTGT
                      ____________________________________________________________
consensus TGAAGAATACCACAGTAATTACATACAGGCAACACATTTTCCAAACTTGAATGGGCTTGT
 
. : . : . : . : . : . :
rJMSF039L04- CTACACACAAGTAGTTCTGCACAATTGAATGTTGAACGTTCGGAGAAAGATATATTGCTG
                      ____________________________________________________________
consensus CTACACACAAGTAGTTCTGCACAATTGAATGTTGAACGTTCGGAGAAAGATATATTGCTG
 
. : . : . : . : . : . :
rJMSF039L04- GAAACAAAATTCATTATCTGGCGAGTTCTTAGCTCGTTGTAAAGATGCTCCAATGATGCT
                      ____________________________________________________________
consensus GAAACAAAATTCATTATCTGGCGAGTTCTTAGCTCGTTGTAAAGATGCTCCAATGATGCT
 
. : . : . : . : . : . :
rJMSF039L04- CTGATGGTAGAATTTCCTTGATCTTTTCAAGTCGTTTCAGAATCTCCAGGAAAGAAGGCC
                      ____________________________________________________________
consensus CTGATGGTAGAATTTCCTTGATCTTTTCAAGTCGTTTCAGAATCTCCAGGAAAGAAGGCC
 
. : . : . : . : . : . :
rJMSF039L04- TCTTGTTCATGTCTGCTGCCCAGCACTGCTCAACTAACTCTTTCAATTCGGGGATAAATC
                      ____________________________________________________________
consensus TCTTGTTCATGTCTGCTGCCCAGCACTGCTCAACTAACTCTTTCAATTCGGGGATAAATC
 
. : . : . : . : . : . :
rJMSF039L04- CTTTTGCCCTGAATATAGGTCTCTGTCCTTCGGCTGCATGTTTAGCTGCTTCATACGGTT
                      ____________________________________________________________
consensus CTTTTGCCCTGAATATAGGTCTCTGTCCTTCGGCTGCATGTTTAGCTGCTTCATACGGTT
 
. : . : . : . : . : . :
rJMSF039L04- GATGGCCTGACAATGGTGGATCCCCTTCTAGCATCTCATATAGTATCATTGCGAAGGAGT
                      ____________________________________________________________
consensus GATGGCCTGACAATGGTGGATCCCCTTCTAGCATCTCATATAGTATCATTGCGAAGGAGT
 
. : . : . : . : . : . :
rJMSF039L04- AAACATCAACCTTTTTGTCATATTTCCGGTGCTTGAAAACTTCAGGGGCCATATATCGAT
                      ____________________________________________________________
consensus AAACATCAACCTTTTTGTCATATTTCCGGTGCTTGAAAACTTCAGGGGCCATATATCGAT
 
. : . : . : . : . : . :
rJMSF039L04- AGCTTCCAGTTTCTCCTGTCATTTTATATACATCATGAGAATTTTGAACCCTAATGAGCT
                      ____________________________________________________________
consensus AGCTTCCAGTTTCTCCTGTCATTTTATATACATCATGAGAATTTTGAACCCTAATGAGCT
 
. : . : . : . : . : . :
rJMSF039L04- TGCTTAATCCAAAGTCTCCAACTTTCAGATGATCTGCACTGGAGTTGACGAGAAGAACAT
                      ____________________________________________________________
consensus TGCTTAATCCAAAGTCTCCAACTTTCAGATGATCTGCACTGGAGTTGACGAGAAGAACAT
 
. : . : . : . : . : . :
rJMSF039L04- TCCTTGGTTTTAGATCCCTGTGAATTATAACATTTGGCTCATTGTGAAGATAAGCCATGC
JMSF039L04+ CTGTGAATTATAACATTTGGCTCATTGTGAAGATAAGCCATGC
                      ____________________________________________________________
consensus TCCTTGGTTTTAGATCCCTGTGAATTATAACATTTGGCTCATTGTGAAGATAAGCCATGC
 
. : . : . : . : . : . :
rJMSF039L04- CTCTAGCAATGTCCATTGCCAAATTGATCGCCATCGATGGGCTGAGTGCACCTTTATCCT
JMSF039L04+ CTCTAGCAATGTCCATTGCCAAATTGATCGCCATCGATGGGCTGAGTGCACCTTTATCCT
                      ____________________________________________________________
consensus CTCTAGCAATGTCCATTGCCAAATTGATCGCCATCGATGGGCTGAGTGCACCTTTATCCT
 
. : . : . : . : . : . :
rJMSF039L04- TCAGATACTGATGAAGATCACCCCCCCTTAAATATTCAGTAATTAACATCAAGGGCTTTT
JMSF039L04+ TCAGATACTGATGAAGATCACCCCCCCTTAAATATTCAGTAATTAACATCAAGGGCTTTT
                      ____________________________________________________________
consensus TCAGATACTGATGAAGATCACCCCCCCTTAAATATTCAGTAATTAACATCAAGGGCTTTT
 
. : . : . : . : . : . :
rJMSF039L04- TGTCAGTAACTGCACCAAGAAATTGCACTATATTTGGATGTCNAAGCTTCACCAACAAAT
JMSF039L04+ TGTCAGTAACTGCACCAAGAAATTGCACTATATTTGGATGTCGAAGCTTCACCAACAAAT
                      ____________________________________________________________
consensus TGTCAGTAACTGCACCAAGAAATTGCACTATATTTGGATGTCGAAGCTTCACCAACAAAT
 
. : . : . : . : . : . :
rJMSF039L04- TTACCTCATGCCTGAAATCCTGAATCACCAAGNCGGTCATCTGAAA
JMSF039L04+ TTACCTCATGCCTGAAATCCTGAATCACCAAG-CGGTCATCTGAAAGATTCGGAAGGATG
JMSF028A17+ ATCACCAAG-CGGTCATCTGAAAGATTCGGAAGGATG
                      ____________________________________________________________
consensus TTACCTCATGCCTGAAATCCTGAATCACCAAG-CGGTCATCTGAAAGATTCGGAAGGATG
 
. : . : . : . : . : . :
JMSF039L04+ CGTTTGATAGCAACAGGTGTTCCACGCCAAGAAGCTTTCACTATCTCACCAAAGGAGCCC
JMSF028A17+ CGTTTGATAGCAACAGGTGTTCCACGCCAAGAAGCTTTCACTATCTCACCAAAGGAGCCC
                      ____________________________________________________________
consensus CGTTTGATAGCAACAGGTGTTCCACGCCAAGAAGCTTTCACTATCTCACCAAAGGAGCCC
 
. : . : . : . : . : . :
JMSF039L04+ TTCCCAATAATAATTGAGTTTGAGAAGTCCAATTCAGTAGGTTCAACTTCCCAGTCACAC
JMSF028A17+ TTCCCAATAATAATTGAGTTTGAGAAGTCCAATTCAGTAGGTTCAACTTCCCAGTCACAC
                      ____________________________________________________________
consensus TTCCCAATAATAATTGAGTTTGAGAAGTCCAATTCAGTAGGTTCAACTTCCCAGTCACAC
 
. : . : . : . : . : . :
JMSF039L04+ TTATTTGGCAGAGGTGGTGGAACAGGCCTTGGTTCAAAATGACTTCCATTTTGCCCATAA
JMSF028A17+ TTATTTGGCAGAGGTGGTGGAACAGGCCTTGGTTCAAAATGACTTCCATTTTGCCCATAA
                      ____________________________________________________________
consensus TTATTTGGCAGAGGTGGTGGAACAGGCCTTGGTTCAAAATGACTTCCATTTTGCCCATAA
 
. : . : . : . : . : . :
JMSF039L04+ GATAGACCACCATACGACTTCAATAATTCAATCATGTTGTGTTTCTTAGCTCCTTCAGCA
JMSF028A17+ GATAGACCACCATACGACTTCAATAATTCAATCATGTTGTGTTTCTTAGCTCCTTCAGCA
                      ____________________________________________________________
consensus GATAGACCACCATACGACTTCAATAATTCAATCATGTTGTGTTTCTTAGCTCCTTCAGCA
 
. : . : . : . : . : . :
JMSF039L04+ TCAGCTAGAGGCGTATTTTTCCATCGATCTTGCGCGTTGACGTCAGCTCCGTACTCGATC
JMSF028A17+ TCAGCTAGAGGCGTATTTTTCCATCGATCTTGCGCGTTGACGTCAGCTCCGTACTCGATC
                      ____________________________________________________________
consensus TCAGCTAGAGGCGTATTTTTCCATCGATCTTGCGCGTTGACGTCAGCTCCGTACTCGATC
 
. : . : . : . : . : . :
JMSF039L04+ AAGCACTTGGCGACATCGATCCAACCGTGGAGAGCAGCGACATGGAGCGGAGTCCGTTTA
JMSF028A17+ AAGCACTTGGCGACATCGATCCAACCGTGGAGAGCAGCGACATGGAGCGGAGTCCGTTTA
                      ____________________________________________________________
consensus AAGCACTTGGCGACATCGATCCAACCGTGGAGAGCAGCGACATGGAGCGGAGTCCGTTTA
 
. : . : . : . : . : . :
JMSF039L04+ TCATAATCTATAGCTTGCACCAGCGTCTTATCTT
JMSF028A17+ TCATAATCTATAGCTTGCACCAGCGTCTTATCTTCCTCGAGGAGCTTCCTCACGGCCGAC
                      ____________________________________________________________
consensus TCATAATCTATAGCTTGCACCAGCGTCTTATCTTCCTCGAGGAGCTTCCTCACGGCCGAC
 
. : . : . : . : . : . :
JMSF028A17+ AGGTCGTTCTGGTGGGCGTGCCACAGTATGAGCGACGTGCGGTTCACTCTGGCCTTGTCC
                      ____________________________________________________________
consensus AGGTCGTTCTGGTGGGCGTGCCACAGTATGAGCGACGTGCGGTTCACTCTGGCCTTGTCC
 
. : . : . : . : . : . :
JMSF028A17+ TTCTTCTTCTCCGCCGTCGGCGCTTCTCCTCCGCTCCCGGTGGCGGAATGATCTGAGCCG
                      ____________________________________________________________
consensus TTCTTCTTCTCCGCCGTCGGCGCTTCTCCTCCGCTCCCGGTGGCGGAATGATCTGAGCCG
 
. : . : . : . : . : . :
JMSF028A17+ CCTTCGCTTCCACTCATATTTCGGGTCGCGCTCGCACCGGATTCGTCTCTCTGTGGGCTT
                      ____________________________________________________________
consensus CCTTCGCTTCCACTCATATTTCGGGTCGCGCTCGCACCGGATTCGTCTCTCTGTGGGCTT