Previous Contig 006502:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028A09Sequence362006502 (4)317006502 (4)
JMSF029A09Sequence362006502 (4)317006502 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029A09- GA
rJMSF029A09+ GA
rJMSF028A09+ GA
JMSF028A09- GA
                      ____________________________________________________________
consensus GA
 
. : . : . : . : . : . :
JMSF029A09- GGGATGCCCAACTTCCAAATTTTGTTCCATGCAGAAAAACTGTTATTATGATGCACAAAT
rJMSF029A09+ GGGATGCCCAACTTCCAAATTTTGTTCCATGCAGAAAAACTGTTATTATGATGCACAAAT
rJMSF028A09+ GGGATGCCCAACTTCCAAATTTTGTTCCATGCAGAAAAACTGTTATTATGATGCACAAAT
JMSF028A09- GGGATGCCCAACTTCCAAATTTTGTTCCATGCAGAAAAACTGTTATTATGATGCACAAAT
                      ____________________________________________________________
consensus GGGATGCCCAACTTCCAAATTTTGTTCCATGCAGAAAAACTGTTATTATGATGCACAAAT
 
. : . : . : . : . : . :
JMSF029A09- ATAAAATCACCCATCAAAGATCTATACCCAGAGCGCACAGTATAATTACCCCTTACATCC
rJMSF029A09+ ATAAAATCACCCATCAAAGATCTATACCCAGAGCGCACAGTATAATTACCCCTTACATCC
rJMSF028A09+ ATAAAATCACCCATCAAAGATCTATACCCAGAGCGCACAGTATAATTACCCCTTACATCC
JMSF028A09- ATAAAATCACCCATCAAAGATCTATACCCAGAGCGCACAGTATAATTACCCCTTACATCC
                      ____________________________________________________________
consensus ATAAAATCACCCATCAAAGATCTATACCCAGAGCGCACAGTATAATTACCCCTTACATCC
 
. : . : . : . : . : . :
JMSF029A09- CCATACCAATACAACAAACTTCATAGTGTAAATTAATAGGAGTCTTATTATTATTATTAG
rJMSF029A09+ CCATACCAATNCAACAAACTTCATAGTGTAAATTAATAGGAGTCTTATTATTATTATTAG
rJMSF028A09+ CCATACCAATACAACAAACTTCATAGTGTAAATTAATAGGAGTCTTATTATTATTATTAG
JMSF028A09- CCATACCAATACAACAAACTTCATAGTGTAAATTAATAGGAGTCTTATTATTATTATTAG
                      ____________________________________________________________
consensus CCATACCAATACAACAAACTTCATAGTGTAAATTAATAGGAGTCTTATTATTATTATTAG
 
. : . : . : . : . : . :
JMSF029A09- AGTTTAATATCAATTTAGAGTTTTTTTACTGACTAGGCAGGAAAATTTCATAGTGACTGC
rJMSF029A09+ AGTTTAATATCAATTTAGAGTTTTTTTACTGACTAGGCAGGAAAATTTCATAGTGACTGC
rJMSF028A09+ AGTTTAATATCAATTTAGAGTTTTTTTACTGACTAGGCAGGAAAATTTCATAGTGACTGC
JMSF028A09- AGTTTAATATCAATTTAGAGTTTTTTTACTGACTAGGCAGGAAAATTTCATAGTGACTGC
                      ____________________________________________________________
consensus AGTTTAATATCAATTTAGAGTTTTTTTACTGACTAGGCAGGAAAATTTCATAGTGACTGC
 
. : . : . : . : . : . :
JMSF029A09- CCNAAGGTAAAATCTATACTGAGTAATCTTTACCTATCTTGTGATCCCTTAACCAATCTA
rJMSF029A09+ CCAAAGGTAAAATCTATACTGAGTAATCTTTACCTATCTTGTGATCCCTTAACCAATCTA
rJMSF028A09+ CCAAAGGTAAAATCTATACTGAGTAATCTTTACCTATCTTGTGATCCCTTAACCAATCTA
JMSF028A09- CCAAAGGTAAAATCTATACTGAGTAATCTTTACCTATCTTGTGATCCCTTAACCAATCTA
                      ____________________________________________________________
consensus CCAAAGGTAAAATCTATACTGAGTAATCTTTACCTATCTTGTGATCCCTTAACCAATCTA
 
. : . : . : . : . : . :
JMSF029A09- GATTACCTAGAGTTGAGTAGTTCAAAGTCTCAAACTAAGCAAATCAATACAAAAAAAAAA
rJMSF029A09+ GA-TACCTAGAGT
rJMSF028A09+ GA-TACCTAGAGT
JMSF028A09- GATTACCTAGAGTTGAGTAGTTCAAAGTCTCAAACTAAGCAAATCAATACAAAAAAAAAA
                      ____________________________________________________________
consensus GATTACCTAGAGTTGAGTAGTTCAAAGTCTCAAACTAAGCAAATCAATACAAAAAAAAAA