Previous Contig 006498:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS003H08Sequence575006498 (4)pir|T02996|T029965e-73N-ethylmaleimide sensitive fusion protein NSF - common tobacco>gb:D86506_1674998
JMFS032C08Sequence594006498 (4)pir|T02996|T029964e-74N-ethylmaleimide sensitive fusion protein NSF - common tobacco>gb:D86506_1674998
JMSF027O20Sequence659006498 (4)pir|T02996|T029967e-72N-ethylmaleimide sensitive fusion protein NSF - common tobacco>gb:D86506_1674998707012575 (3)pir|T02996|T029962e-91N-ethylmaleimide sensitive fusion protein NSF - common tobacco>gb:D86506_1674998
JMSF043B01Sequence827006498 (4)pir|T02996|T02996e-110N-ethylmaleimide sensitive fusion protein NSF - common tobacco>gb:D86506_1674998

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043B01+ GGTGGCCCATAAANGGAGCATTCCCTTAACATGCT
                      ____________________________________________________________
consensus GGTGGCCCATAAANGGAGCATTCCCTTAACATGCT
 
. : . : . : . : . : . :
JMSF043B01+ TGATGCCAAGTTTAGATGCGACGTGTGGAGGAAAAACCCTGGAAGCAAAAGNTCTTCGAA
                      ____________________________________________________________
consensus TGATGCCAAGTTTAGATGCGACGTGTGGAGGAAAAACCCTGGAAGCAAAAGNTCTTCGAA
 
. : . : . : . : . : . :
JMSF043B01+ ATATATCAGCAAACTCGGCACTCAAACCACCAATACCTAATGACTCCAGGTTGAACTCTT
                      ____________________________________________________________
consensus ATATATCAGCAAACTCGGCACTCAAACCACCAATACCTAATGACTCCAGGTTGAACTCTT
 
. : . : . : . : . : . :
JMSF043B01+ TCTGCCTGAAAATGCTGCTACTAGCAGCTTCACGCTGGTTGGTTATCTTTATTCCACTTC
                      ____________________________________________________________
consensus TCTGCCTGAAAATGCTGCTACTAGCAGCTTCACGCTGGTTGGTTATCTTTATTCCACTTC
 
. : . : . : . : . : . :
JMFS032C08+ TGCAGCTTCAAAAATAATATATGTCTCCGAAGAAAGTAGCCCTCTTTCAATTTTAT
JMSF043B01+ CATTTGCAGCTTCAAAAATAATATATGTCTCCGAAGAAAGTAGCCCTCTTTCAATTTTAT
JMFS003H08+ CAGCTTCAAAAATAATATATGTCTCCGAAGAAAGTAGCCCTCTTTCAATTTTAT
JMSF027O20+ TGCAGCTTCAAAAATAATATATGTCTCCGAAGAAAGTAGCCCTCTTTCAATTTTAT
                      ____________________________________________________________
consensus CATTTGCAGCTTCAAAAATAATATATGTCTCCGAAGAAAGTAGCCCTCTTTCAATTTTAT
 
. : . : . : . : . : . :
JMFS032C08+ TTGATTTTGAATGTCCCTCAATTTGAGCTTGATTAACAGTGAAGATATAACCATTGCCAT
JMSF043B01+ TTGATTTTGAATGTCCCTCAATTTGAGCTTGATTAACAGTGAAGATATAACCATTGCCAT
JMFS003H08+ TTGATTTTGAATGTCCCTCAATTTGAGCTTGATTAACAGTGAAGATATAACCATTGCCAT
JMSF027O20+ TTGATTTTGAATGTCGCTCAATTTGAGCTTGATTAACAGTGAAGATATAACCATTGCCAT
                      ____________________________________________________________
consensus TTGATTTTGAATGTCCCTCAATTTGAGCTTGATTAACAGTGAAGATATAACCATTGCCAT
 
. : . : . : . : . : . :
JMFS032C08+ GGTATTCAAATGTCACCTTTTGTCCAGCTGTCATAACCTGATTTACAAATCTCTTTCGAA
JMSF043B01+ GGTATTCAAATGTCACCTTTTGTCCAGCTGTCATAACCTGATTTACAAATCTCTTTCGAA
JMFS003H08+ GGTATTCAAATGTCACCTTTTGTCCAGCTGTCATAACCTGATTTACAAATCTCTTTCGAA
JMSF027O20+ GGTATTCAAATGTCACCTTTTGTCCAGCTGTCATAACCTGATTTACAAATCTCTTTCGAA
                      ____________________________________________________________
consensus GGTATTCAAATGTCACCTTTTGTCCAGCTGTCATAACCTGATTTACAAATCTCTTTCGAA
 
. : . : . : . : . : . :
JMFS032C08+ TTTGATTACCCATCTGAACAGCATCAACCTGCTCATCTTTTGTTCCCTTTCTTACAAAGT
JMSF043B01+ TTTGATTACCCATCTGAACAGCATCAACCTGCTCATCTTTTGTTCCCTTTCTTACAAAGT
JMFS003H08+ TTTGATTACCCATCTGAACAGCATCAACCTGCTCATCTTTTGTTCCCTTTCTTACAAAGT
JMSF027O20+ TTTGATTACCCATCTAAACAGCATCAACCTGCTCATCTTTTGTTCCCTTTCTTACAAAGT
                      ____________________________________________________________
consensus TTTGATTACCCATCTGAACAGCATCAACCTGCTCATCTTTTGTTCCCTTTCTTACAAAGT
 
. : . : . : . : . : . :
JMFS032C08+ CCAATTCAAGGGTCAACAAAGCAAGATTGAAATCTTCAGGTGGGATGAATCTGCTCACAG
JMSF043B01+ CCAATTCAAGGGTCAACAAAGCAAGATTGAAATCTTCAGGTGGGATGAATCTGCTCACAG
JMFS003H08+ CCAATTCAAGGGTCAACAAAGCAAGATTGAAATCTTCAGGTGGGATGAATCTGCTCACAG
JMSF027O20+ CCAATTCAAGGGTCAACAAAGCAAGATTGAAATCTTCAGGTGGGATGAATCTGCTCACAG
                      ____________________________________________________________
consensus CCAATTCAAGGGTCAACAAAGCAAGATTGAAATCTTCAGGTGGGATGAATCTGCTCACAG
 
. : . : . : . : . : . :
JMFS032C08+ GTATGGAGTCCCCAGTAGAAACCTTCGCATATCGGCGATGAATAACATTAAGACCAATTT
JMSF043B01+ GTATGGAGTCCCCAGTAGAAACCTTCGCATATCGGCGATGAATAACATTAAGACCAATTT
JMFS003H08+ GTATGGAGTCCCCAGTAGAAACCTTCGCATATCGGCGATGAATAACATTAAGACCAATTT
JMSF027O20+ GTATGGAGTCCCCAGTAGAAACCTTCGCATATCGGCGATGAATAACATTAAGACCAATTT
                      ____________________________________________________________
consensus GTATGGAGTCCCCAGTAGAAACCTTCGCATATCGGCGATGAATAACATTAAGACCAATTT
 
. : . : . : . : . : . :
JMFS032C08+ GGCCATTGGAAATAGAATCATGCGCAGAAATGGAAAGAACGTAAGCATCGGCCACGATAG
JMSF043B01+ GGCCATTGGAAATAGAATCATGCGCAGAAATGGAAAGAACGTAAGCATCGGCCACGATAG
JMFS003H08+ GGCCATTGGAAATAGAATCATGCGCAGAAATGGAAAGAACGTAAGCATCGGCCACGATAG
JMSF027O20+ GGCCATNGGAAATAGAATCATGCGCAGAAATGGAAAGAACGTAAGCATCGGCCACGATAG
                      ____________________________________________________________
consensus GGCCATTGGAAATAGAATCATGCGCAGAAATGGAAAGAACGTAAGCATCGGCCACGATAG
 
. : . : . : . : . : . :
JMFS032C08+ CGTAGGCCATTTTCGTCCCCGGAACGACAAAGTTCCGGAGATCTGCCTGGGAGCAATATG
JMSF043B01+ CGTAGGCCATTTTCGTCCCCGGAACGACAAAGTTCCGGAGATCTGCCTGGGAGCAATATG
JMFS003H08+ CGTAGGCCATTTTCGTCCCCGGAACGACAAAGTTCCGGAGATCTGCCTGGGAGCAATATG
JMSF027O20+ CGTAGGCCATTTTCGTCCCCGGAACGACAAAGTTCCGGAGATCTGCCTGGGAGCAATATG
                      ____________________________________________________________
consensus CGTAGGCCATTTTCGTCCCCGGAACGACAAAGTTCCGGAGATCTGCCTGGGAGCAATATG
 
. : . : . : . : . : . :
JMFS032C08+ CGAAGTTGGTGTAGGCGAGATCTTTCGCCGGCGTGTTGGTCACGATCATCTCTAACGATG
JMSF043B01+ CGAAGTTGGTGTAGGCGAGATCTTTCGCCGGCGTGTTGGTCACGATCATCTCTAACGATG
JMFS003H08+ CGAAGTTGGTGTAGGCGAGATCTTTCGCCGGCGTGTTGGTCACGATCATCTCTAACGATG
JMSF027O20+ CGAAGTTGGTGTAGGCGAGATCTTTCGCCGGCGTGTTGGTCACGATCATCTCTAACGATG
                      ____________________________________________________________
consensus CGAAGTTGGTGTAGGCGAGATCTTTCGCCGGCGTGTTGGTCACGATCATCTCTAACGATG
 
. : . : . : . : . : . :
JMFS032C08+ ACATCCGTGCCATTTCTGAAACTC
JMSF043B01+ ACATCCGTGCCATTTCTGAAACTC
JMFS003H08+ ACATCCGTGCCATTTCTGAAACTCGCTCTCAACCGAGATCA
JMSF027O20+ ACATCCGTGCCATTTCTGAAACTCGCTCTCAACCGAGATCAATCAACCGAAATCAGGAAT
                      ____________________________________________________________
consensus ACATCCGTGCCATTTCTGAAACTCGCTCTCAACCGAGATCAATCAACCGAAATCAGGAAT
 
. : . : . : . : . : . :
JMSF027O20+ AGAATTTGAATATTGGAAACTTTTCGATTTGGATTTAAAATCTTTTTAGCTTTGATGCCC
                      ____________________________________________________________
consensus AGAATTTGAATATTGGAAACTTTTCGATTTGGATTTAAAATCTTTTTAGCTTTGATGCCC