Previous Contig 006495:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013O24Sequence563006495 (5)gb:BT002315_16359181e-25Arabidopsis thaliana clone C105038 unknown protein (At4g31880) mRNA, complete cd
JMFF022C01Sequence479006495 (5)gb:BT002315_16359180.048Arabidopsis thaliana clone C105038 unknown protein (At4g31880) mRNA, complete cd720012572 (2)gb:AP005930_18602832e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P050
JMFS018A01Sequence626006495 (5)gb:BT002315_16359181e-31Arabidopsis thaliana clone C105038 unknown protein (At4g31880) mRNA, complete cd
JMFS167F05Sequence624006495 (5)gb:BT002315_16359187e-31Arabidopsis thaliana clone C105038 unknown protein (At4g31880) mRNA, complete cd
JMSF027N20Sequence673006495 (5)gb:BT002315_16359184e-04Arabidopsis thaliana clone C105038 unknown protein (At4g31880) mRNA, complete cd662012572 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS018A01+ CCTTTGAAACATTGTCAAGAATNTGCGCAGCCTTCGAATA
JMFS167F05+ AACATTGTCAAGAATTTGCGCAGCCTTCGAATA
                      ____________________________________________________________
consensus CCTTTGAAACATTGTCAAGAATTTGCGCAGCCTTCGAATA
 
. : . : . : . : . : . :
JMFS018A01+ GCAGTGACTCTTGACATTTTCTAACTTCTCAAATGTTCCTACGATGTGCTGAAAAATTTC
JMFS167F05+ GCAGTGACTCTTGACATTTTCTAACTTCTCAAATGTTCCTACGATGTGCTGAAAAATTTC
JMFF013O24+ TGAAAAATTTC
                      ____________________________________________________________
consensus GCAGTGACTCTTGACATTTTCTAACTTCTCAAATGTTCCTACGATGTGCTGAAAAATTTC
 
. : . : . : . : . : . :
JMFS018A01+ CTTCATTACAGCATCATCGTAAGGTTGACGTGGTGCAGTTATTCTCATTATTTCACTGAG
JMFS167F05+ CTTCATTACAGCATCATCGTAAGGTTGACGTGGTGCAGTTATTCTCATTATTTCACTGAG
JMFF013O24+ CTTCATTACAGCATCATCGTAAGGTTGACGTGGTGCAGTTATTCTCATTATTTCACTGAG
                      ____________________________________________________________
consensus CTTCATTACAGCATCATCGTAAGGTTGACGTGGTGCAGTTATTCTCATTATTTCACTGAG
 
. : . : . : . : . : . :
JMFS018A01+ ACACAATACAACTGAAACTTTTACAGCTTCATCAGAATGTACCAAAAGCTCTGAACCAAT
JMFS167F05+ ACACAATACAACTGAAACTTTTACAGCTTCATCAGAATGTACCAAAAGCTCTGAACCAAT
JMFF013O24+ ACACAATACAACTGAAACTTTTACAGCTTCATCAGAATGTACCAAAAGCTCTGAACCAAT
                      ____________________________________________________________
consensus ACACAATACAACTGAAACTTTTACAGCTTCATCAGAATGTACCAAAAGCTCTGAACCAAT
 
. : . : . : . : . : . :
JMFS018A01+ TAGCGCTTTCATTATTGGATGAAGGGCATTCCTCATGGTCTCTGAAGGGGCTTGCCCTAC
JMFS167F05+ TAGCGCTTTCATTATTGGATGAAGGGCATTCCTCATGGTCTCTGAAGGGGCTTGCCCTAC
JMFF013O24+ TAGCGCTTTCATTATTGGATGAAGGGCATTCCTCATGGTCTCTGAAGGGGCTTGCCCTAC
JMSF027N20+ GGGCTTGCCCTAC
                      ____________________________________________________________
consensus TAGCGCTTTCATTATTGGATGAAGGGCATTCCTCATGGTCTCTGAAGGGGCTTGCCCTAC
 
. : . : . : . : . : . :
JMFS018A01+ CCTGACTAGTAGGGATTCGACTTTATCGAGGAAGCTGAGAAGCTCATCATTAGAAGAAGG
JMFS167F05+ CCTGACTAGTAGGGATTCGACTTTATCGAGGAAGCTGAGAAGCTCATCATTAGAAGAAGG
JMFF013O24+ CCTGACTAGTAGGGATTCGACTTTATCGAGGAAGCTGAGAAGCTCATCATTAGAAGAAGG
JMFF022C01+ GGAAGCTGAGAAGCTCATCATTAGAAGAAGG
JMSF027N20+ CCTGACTAGTAGGGATTCGACTTTATCGAGGAAGCTGAGAAGCTCATCATTAGAAGAAGG
                      ____________________________________________________________
consensus CCTGACTAGTAGGGATTCGACTTTATCGAGGAAGCTGAGAAGCTCATCATTAGAAGAAGG
 
. : . : . : . : . : . :
JMFS018A01+ GGGAGTGAAAAGCCTAACCCCATAATCTATGACCTCCTCCTCAAGGTCTTTCTCCGAAGG
JMFS167F05+ GGGAGTGAAAAGCCTAACCCCATAATCTATGACCTCCTCCTCAAGGTCTTTCTCCGAAGG
JMFF013O24+ GGGAGTGAAAAGCCTAACCCCATAATCTATGACCTCCTCCTCAAGGTCTTTCTCCGAAGG
JMFF022C01+ GGGAGTGAAAAGCCTAACCCCATAATCTATGACCTCCTCCTCAAGGTCTTTCTCCGAAGG
JMSF027N20+ GGGAGTGAAAAGCCTAACCCCATAATCTATGACCTCCTCCTCAAGGTCTTTCTCCGAAGG
                      ____________________________________________________________
consensus GGGAGTGAAAAGCCTAACCCCATAATCTATGACCTCCTCCTCAAGGTCTTTCTCCGAAGG
 
. : . : . : . : . : . :
JMFS018A01+ AGGGGTAGCAGAAGAAGAAGCCACCACCATTTCTCAAGAATCAGCCCTCAATCAAAAATT
JMFS167F05+ AGGGGTAGCAGAAGAAGAAGCCACCACCATTTCTCAAGAATCAGCCCTCAATCAAAAATT
JMFF013O24+ AGGGGTAGCAGAAGAAGAAGCCACCACCATTTCTCAAGAATCAGCCCTCAATCAAAAATT
JMFF022C01+ AGGGGTAGCAGAAGAAGAAGCCACCACCATTTCTCAAGAATCAGCCCTCAATCAAAAATT
JMSF027N20+ AGGGGTAGCAGAAGAAGAAGCCACCACCATTTCTCAAGAATCAGCCCTCAATCAAAAATT
                      ____________________________________________________________
consensus AGGGGTAGCAGAAGAAGAAGCCACCACCATTTCTCAAGAATCAGCCCTCAATCAAAAATT
 
. : . : . : . : . : . :
JMFS018A01+ CAGAGTCAAGAACTCAAAGCCCCCAATTTCATGATAAACCCTGATTTATGAATTACTGCA
JMFS167F05+ CAGAGTCAAGAACTCAAAGCCCCCAATTTCATGATAAACCCTGATTTATGAATTACTGCA
JMFF013O24+ CAGAGTCAAGAACTCAAAGCCCCCAATTTCATGATAAACCCTGATTTATGAATTACTGCA
JMFF022C01+ CAGAGTCAAGAACTCAAAGCCCCCAATTTCATGATAAACCCTGATTTATGAATTACTGCA
JMSF027N20+ CAGAGTCAAGAACTCAAAGCCCCCAATTTCATGATAAACCCTGATTTATGAATTACTGCA
                      ____________________________________________________________
consensus CAGAGTCAAGAACTCAAAGCCCCCAATTTCATGATAAACCCTGATTTATGAATTACTGCA
 
. : . : . : . : . : . :
JMFS018A01+ GAATCCCGGGTTTGGAATCCGTGAAGCTGTTTCTTTTGGAATTTTTCTGCCCTTTTTGGG
JMFS167F05+ GAATCCCGGGTTTGGAATCCGTGAAGCTGTTTCTTTTGGAATTTTTCTGCCCTTTTTGGG
JMFF013O24+ GAATCCCGGGTTTGGAATCCGTGAAGCTGTTTCTTTTGGAATTTTTCTGCCCTTTTTGGG
JMFF022C01+ GAATCCCGGGTTTGGAATCCGTGAAGCTGTTTCTTTTGGAATTTTTCTGCCCTTTTTGGG
JMSF027N20+ GAATCCCGGGTTTGGAATCCGTGAAGCTGTTTCTTTTGGAATTTTTCTGCCCTTTTTGGG
                      ____________________________________________________________
consensus GAATCCCGGGTTTGGAATCCGTGAAGCTGTTTCTTTTGGAATTTTTCTGCCCTTTTTGGG
 
. : . : . : . : . : . :
JMFS018A01+ AGTCTGATCAATTGAATGCCATGCAAGCTTTAGGCCAAAGGCGGTT
JMFS167F05+ AGTCTGATCAATTGAATGCCATGCAAGCTTTAGGCCAAAGGCGGTTTCAGC
JMFF013O24+ AGTCTGATCAATTGAATGCCATGCAAGCTTTAGGCCAAAGGCGGTTTCAGCTCTGGTGTG
JMFF022C01+ AGTCTGATCAATTGAATGCCATGCAAGCTTTAGGCCAAAGGCGGTTTCAGCTCTGGTGTG
JMSF027N20+ AGTCTGATCAATTGAATGCCATGCAAGCTTTAGGCCAAAGGCGGTTTCAGCTCTGGTGTG
                      ____________________________________________________________
consensus AGTCTGATCAATTGAATGCCATGCAAGCTTTAGGCCAAAGGCGGTTTCAGCTCTGGTGTG
 
. : . : . : . : . : . :
JMFF013O24+ TTACTATGTAC
JMFF022C01+ TTACTATGTAC
JMSF027N20+ TTACTATGTACAGGTTTCTGAGAATACTCCGTACTATTATTATTGCCGGGATCGAATTGT
                      ____________________________________________________________
consensus TTACTATGTACAGGTTTCTGAGAATACTCCGTACTATTATTATTGCCGGGATCGAATTGT
 
. : . : . : . : . : . :
JMSF027N20+ GATTGCTGCGGGCTGCGCCTTCCAGAAGTGTATTTTATCTCCGCCTTCCAGAACTAAAAA
                      ____________________________________________________________
consensus GATTGCTGCGGGCTGCGCCTTCCAGAAGTGTATTTTATCTCCGCCTTCCAGAACTAAAAA
 
. : . : . : . : . : . :
JMSF027N20+ CCGACGCCGCCGTTGTCCGCCATCCGCGACTCCAAGTCGCATCCTCAACAGCGTCACACT
                      ____________________________________________________________
consensus CCGACGCCGCCGTTGTCCGCCATCCGCGACTCCAAGTCGCATCCTCAACAGCGTCACACT
 
. : . : . : . : . : . :
JMSF027N20+ GCGTTCTTCATGTCGTTGTCCATGTATGCTCGTAGTTGCCCTCGTCAACGACGATCGGAG
                      ____________________________________________________________
consensus GCGTTCTTCATGTCGTTGTCCATGTATGCTCGTAGTTGCCCTCGTCAACGACGATCGGAG
 
. : . : . : . : . : . :
JMSF027N20+ TCAAAATCACCGGCGACAAATTCCAGGCAGTAGGTATTACCATGCAAAATTTCGACAATC
                      ____________________________________________________________
consensus TCAAAATCACCGGCGACAAATTCCAGGCAGTAGGTATTACCATGCAAAATTTCGACAATC