Previous Contig 006494:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H04Sequence541006494 (6)pir|C96740|C967402e-52hypothetical protein F14O23.16 [imported] - Arabidopsis thaliana>gb:AE005173_894674006494 (6)pir|C96740|C967404e-59hypothetical protein F14O23.16 [imported] - Arabidopsis thaliana>gb:AE005173_894
JMFN003M20Sequence624006494 (6)pir|C96740|C967404e-59hypothetical protein F14O23.16 [imported] - Arabidopsis thaliana>gb:AE005173_894
JMFN033L02Sequence618006494 (6)pir|C96740|C967404e-58hypothetical protein F14O23.16 [imported] - Arabidopsis thaliana>gb:AE005173_894
JMSF027N11Sequence670006494 (6)pir|C96740|C967404e-59hypothetical protein F14O23.16 [imported] - Arabidopsis thaliana>gb:AE005173_894753006494 (6)pir|C96740|C967405e-59hypothetical protein F14O23.16 [imported] - Arabidopsis thaliana>gb:AE005173_894

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027N11- CCAGAGAGTATCTGAGGAGTGGTATTATGTTAA
                      ____________________________________________________________
consensus CCAGAGAGTATCTGAGGAGTGGTATTATGTTAA
 
. : . : . : . : . : . :
rJMFF010H04- AACTTAGAAGTTTCAGAA
rJMSF027N11- ATTTATGTGAAACGCAGTAATAGAGAACACAACAGAAGGCAAAACTTAGAAGTTTCAGAA
JMSF027N11+ AGTTTCAGAA
                      ____________________________________________________________
consensus ATTTATGTGAAACGCAGTAATAGAGAACACAACAGAAGGCAAAACTTAGAAGTTTCAGAA
 
. : . : . : . : . : . :
JMFN003M20+ AGGTAGTTTCAGAAGATTCATCAACTAGTTTAAGGTGTTAAG
JMFN033L02+ AGTTTAAGGTAGTTCAGGAAGATTCATCAACTAGTNTAAGGTGTTAAG
rJMFF010H04- GATTCATCGACTAGTTTAAGGTAGTTTCAGAAGATTCATCAACTAGTTTAAGGTGTTAAG
rJMSF027N11- GATTCATCGACTAGTTTAAGGTAGTTTCAGAAGATTCATCAACTAGTTTAAGGTGTTAAG
JMSF027N11+ GATTCATCGACTAGTTTAAGGTAGTTTCAGAAGATTCATCAACTAGTTTAAGGTGTTAAG
                      ____________________________________________________________
consensus GATTCATCGACTAGTTTAAGGTAGTTTCAGAAGATTCATCAACTAGTTTAAGGTGTTAAG
 
. : . : . : . : . : . :
JMFN003M20+ TACCTAGCGACGTTTTTCCAAGAAATCCTTGGTTCTCTTCCTCATTCGTGTGAACACAAT
JMFN033L02+ TACCTAGCGACGTTTTTCCAAGAAATCCTTGGTTCTCTTCCTCATTCGTGTGAACACAAT
rJMFF010H04- TACCTAGCGACGTTTTTCCAAGAAATCCTTGGTTCTCTTCCTCATTCGTGTGAACACAAT
JMFF010H04+ ACAAT
rJMSF027N11- TACCTAGCGACGTTTTTCCAAGAAATCCTTGGTTCTCTTCCTCATTCGTGTGAACACAAT
JMSF027N11+ TACCTAGCGACGTTTTTCCAAGAAATCCTTGGTTCTCTTCCTCATTCGTGTGAACACAAT
                      ____________________________________________________________
consensus TACCTAGCGACGTTTTTCCAAGAAATCCTTGGTTCTCTTCCTCATTCGTGTGAACACAAT
 
. : . : . : . : . : . :
JMFN003M20+ GACAACGCAAGCAAGGATCCATGGAGGGATGCGTCCACCAGAAAAGTTCAACTTTTTGGC
JMFN033L02+ GACAACGCAAGCAAGGATCCATGGAGGGATGCGTCCACCAGAAAAGTTCAACTTTTTGGC
rJMFF010H04- GACAACGCAAGCAAGGATCCATGGAGGGATGCGTCCACCAGAAAAGTTCAACTTTTTGGC
JMFF010H04+ GACAACGCAAGCAAGGATCCATGGAGGGATGCGTCCACCAGAAAAGTTCAACTTTTTGGC
rJMSF027N11- GACAACGCAAGCAAGGATCCATGGAGGGATGCGTCCACCAGAAAAGTTCAACTTTTTGGC
JMSF027N11+ GACAACGCAAGCAAGGATCCATGGAGGGATGCGTCCACCAGAAAAGTTCAACTTTTTGGC
                      ____________________________________________________________
consensus GACAACGCAAGCAAGGATCCATGGAGGGATGCGTCCACCAGAAAAGTTCAACTTTTTGGC
 
. : . : . : . : . : . :
JMFN003M20+ CCATTCAGGAGTCTCTTTCATCACCACTACAATCAATATGGTAATGGCAACAACCCCAAT
JMFN033L02+ CCATTCAGGAGTCTCTTTCATCACCACTACAATCAATATGGTAATGGCAACAACCCCAAT
rJMFF010H04- CCATTCAGGAGTCTCTTTCATCACCACTACAATCAATATGGTAATGGCAACAACCCCAAT
JMFF010H04+ CCATTCAGGAGTCTCTTTCATCACCACTACAATCAATATGGTAATGGCAACAACCCCAAT
rJMSF027N11- CCATTCAGGAGTCTCTTTCATCACCACTACAATCAATATGGTAATGGCAACAACCCCAAT
JMSF027N11+ CCATTCAGGAGTCTCTTTCATCACCACTACAATCAATATGGTAATGGCAACAACCCCAAT
                      ____________________________________________________________
consensus CCATTCAGGAGTCTCTTTCATCACCACTACAATCAATATGGTAATGGCAACAACCCCAAT
 
. : . : . : . : . : . :
JMFN003M20+ CAATATTCTGGTAATCGGTTGGATTAACGAATCCTTGGGCTCTCCATCGACATAAATAAC
JMFN033L02+ CAATATTCTGGTAATCGGTTGGATTAACGAATCCTTGGGCTCTCCATCGACATAAATAAC
rJMFF010H04- CAATATTCTGGTAATCGGTTGGATTAACGAATCCTTGGGCTCTCCATCGACATAAATAAC
JMFF010H04+ CAATATTCTGGTAATCGGTTGGATTAACGAATCCTTGGGCTCTCCATCGACATAAATAAC
rJMSF027N11- CAATATTCTGGTAATCGGTTGGATTAACGAATCCTTGGGCTCTCCATCGACATAAATAAC
JMSF027N11+ CAATATTCTGGTAATCGGTTGGATTAACGAATCCTTGGGCTCTCCATCGACATAAATAAC
                      ____________________________________________________________
consensus CAATATTCTGGTAATCGGTTGGATTAACGAATCCTTGGGCTCTCCATCGACATAAATAAC
 
. : . : . : . : . : . :
JMFN003M20+ GGATCCATGAGTGTAGGTGAGGATGGATCGGCCGTTGCGAGGGTTGAAGCGGATGGGCAC
JMFN033L02+ GGATCCATGAGTGTAGGTGAGGATGGATCGGCCGTTGCGAGGGTTGAAGCGGATGGGCAC
rJMFF010H04- GGATCCATGAGTGTAGGTGAGGATGGATCGGCCGTTGCGAGGGTTGAAGCGGATGGGCAC
JMFF010H04+ GGATCCATGAGTGTAGGTGAGGATGGATCGGCCGTTGCGAGGGTTGAAGCGGATGGGCAC
rJMSF027N11- GGATCCATGAGTGTAGGTGAGGATGGATCGGCCGTTGCGAGGGTTGAAGCGGATGGGCAC
JMSF027N11+ GGATCCATGAGTGTAGGTGAGGATGGATCGGCCGTTGCGAGGGTTGAAGCGGATGGGCAC
                      ____________________________________________________________
consensus GGATCCATGAGTGTAGGTGAGGATGGATCGGCCGTTGCGAGGGTTGAAGCGGATGGGCAC
 
. : . : . : . : . : . :
JMFN003M20+ GCCCCGACCCGAATCAGGGTTGAAGGCGTAGATGGATTTGAAGGCATACTTGTCGAGGAT
JMFN033L02+ GCCCCGACCCGAATCAGGGTTGAAGGCGTAGATGGATTTGAAGGCATACTTGTCGAGGAT
rJMFF010H04- GCCCCGACCCGAATCAGGGTTGAAGGCGTAGATGGATTTGAAGGCATACTTGTCGAGGAT
JMFF010H04+ GCCCCGACCCGAATCAGGGTTGAAGGCGTAGATGGATTTGAAGGCATACTTGTCGAGGAT
rJMSF027N11- GCCCCGACCCGAATCAGGGTTGAAGGCGTAGATGGATTTGAAGGCATACTTGTCGAGGAT
JMSF027N11+ GCCCCGACCCGAATCAGGGTTGAAGGCGTAGATGGATTTGAAGGCATACTTGTCGAGGAT
                      ____________________________________________________________
consensus GCCCCGACCCGAATCAGGGTTGAAGGCGTAGATGGATTTGAAGGCATACTTGTCGAGGAT
 
. : . : . : . : . : . :
JMFN003M20+ ATCGCGAACCTCCAGCTGATCCTGTTCCCAACCACCCAGGCTGCACTTGACCACCTCGAT
JMFN033L02+ ATCGCGAACCTCCAGCTGATCCTGTTCCCAACCACCCAGGCTGCACTTGACCACCTCGAT
rJMFF010H04- ATCGCGAACCTCCAGCTGATCCTGTTCCCAACCACCCAGGCTGCACTTGACCACCTCGAT
JMFF010H04+ ATCGCGAACCTCCAGCTGATCCTGTTCCCAACCACCCAGGCTGCACTTGACCACCTCGAT
rJMSF027N11- ATCGCGAACCTCCAGCTGATCCTGTTCCCAACCACCCAGGCTGCACTTGACCACCTCGAT
JMSF027N11+ ATCGCGAACCTCCAGCTGATCCTGTTCCCAACCACCCAGGCTGCACTTGACCACCTCGAT
                      ____________________________________________________________
consensus ATCGCGAACCTCCAGCTGATCCTGTTCCCAACCACCCAGGCTGCACTTGACCACCTCGAT
 
. : . : . : . : . : . :
JMFN003M20+ CGGGCCCTTTCCTTGCCGGTAGAGATGAATTTCCACCTCCGGAACCTTGGCGCCCACTGT
JMFN033L02+ CGGGCCCTTTCCTTGCCGGTAGAGATGAATTTCCACCTCCGGAACCTTGGCGCCCACTGT
rJMFF010H04- CGGGCCCTTTCCTTGCCGGTAGAGATGAATTTCCACCTCCGGAACCTTGGCGCCCACTGT
JMFF010H04+ CGGGCCCTTTCCTTGCCGGTAGAGATGAATTTCCACCTCCGGAACCTTGGCGCCCACTGT
rJMSF027N11- CGGGCCCTTTCCTTGCCGGTAGAGATGAATTTCCACCTCCGGAACCTTGGCGCCCACTGT
JMSF027N11+ CGGGCCCTTTCCTTGCCGGTAGAGATGAATTTCCACCTCCGGAACCTTGGCGCCCACTGT
                      ____________________________________________________________
consensus CGGGCCCTTTCCTTGCCGGTAGAGATGAATTTCCACCTCCGGAACCTTGGCGCCCACTGT
 
. : . : . : . : . : . :
JMFN003M20+ CGGATCCGGGTTCGATAAAAGCGGAGCCGACTCGCCGGCGGCGTTGGTCGCACGGCTCTC
JMFN033L02+ CGGATCCGGGTTCGATAAAAGCGGAGCCGACTCGCCGGCGGCGTTGGTCGCACGGCTCTC
rJMFF010H04- CGGATCCGGGTTCGATAAAAGCGGAGCCGACTCGCCGGCGGCGTTGGTCGCACGGCTCTC
JMFF010H04+ CGGATCCGGGTTCGATAAAAGCGGAGCCGACTCGCCGGCGGCGTTGGTCGCACGGCTCTC
rJMSF027N11- CGGATCCGGGTTCGATAAAAGCGGAGCCGACTCGCCGGCGGCGTTGGTCGCACGGCTCTC
JMSF027N11+ CGGATCCGGGTTCGATAAAAGCGGAGCCGACTCGCCGGCGGCGTTGGTCGCACGGCTCTC
                      ____________________________________________________________
consensus CGGATCCGGGTTCGATAAAAGCGGAGCCGACTCGCCGGCGGCGTTGGTCGCACGGCTCTC
 
. : . : . : . : . : . :
JMFN003M20+ TTCGATTTCTACCATATCCGTTGGACCGTTTCTCTCTTTACA
JMFN033L02+ TTCGATTTCTACCATATCCGTTGGACCGTT
rJMFF010H04- TTCGATTTCTACCATATCCGTTGGACCGTTTCTCTCTTTACAGTTAATGTATAGG
JMFF010H04+ TTCGATTTCTACCATATCCGTTGGACCGTTTCTCTCTTTACAGTTAATGTATAGG
rJMSF027N11- TTCGATTTCTACCATATCCGTTGGACCGTTTCTCTCTTTACAGTTAATGTATAGG
JMSF027N11+ TTCGATTTCTACCATATCCGTTGGACCGTTTCTCTCTTTACAGTTAATGTATAGGTGGCC
                      ____________________________________________________________
consensus TTCGATTTCTACCATATCCGTTGGACCGTTTCTCTCTTTACAGTTAATGTATAGGTGGCC