Previous Contig 006480:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022C21Sequence482006480 (16)gb:AF232062_17793353e-64Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.655006480 (16)gb:AF232062_17793352e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.
JMFF024G04Sequence431006480 (16)gb:AF232062_17793352e-55Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.686006480 (16)gb:AF232062_17793353e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.
JMFF036F01Sequence598006480 (16)gb:AF232062_17793352e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.649006480 (16)gb:AF232062_17793352e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.
JMFN014K14Sequence623006480 (16)gb:AF232062_17793352e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.
JMFN018C02Sequence577006480 (16)gb:AF232062_17793352e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.
JMFN032N12Sequence624006480 (16)gb:AF232062_17793352e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.
JMFN038N16Sequence584006480 (16)gb:AF232062_17793352e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.
JMSF027K24Sequence640006480 (16)gb:AF232062_17793352e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.671006480 (16)gb:AF232062_17793353e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.
JMSF029H04Sequence641006480 (16)gb:AF232062_17793352e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.682006480 (16)gb:AF232062_17793353e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.
JMSF044K01Sequence729006480 (16)gb:AF232062_17793353e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.673006480 (16)gb:AF232062_17793353e-67Solanum tuberosum multiprotein bridging factor 1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044K01+ TTTTTTTTTTG
                      ____________________________________________________________
consensus TTTTTTTTTTG
 
. : . : . : . : . : . :
rJMFF024G04- ATTGTAAACTGAAACACAATCACATTACA
rJMSF029H04- CTGAAACACAATCACATTACA
rJMSF027K24- AATCACATTACA
rJMSF044K01- CAATCACATTACA
rJMFF036F01- ATTGTAAACTGAAACACAATCACATTACA
JMSF044K01+ TTTTTTTCAAACAACCAGTCACCTCATATTTATTGTAAACTGAAACACAATCACATTACA
                      ____________________________________________________________
consensus TTTTTTTCAAACAACCAGTCACCTCATATTTATTGTAAACTGAAACACAATCACATTACA
 
. : . : . : . : . : . :
rJMFF024G04- CAGCAAATCTTGTCCTTAAAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
rJMSF029H04- CAGCAAATCTTGTCCTTAAAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
rJMSF027K24- CAGCAAATCTTGTCCTTAAAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
rJMSF044K01- CAGCAAATCTTGTCCTTAAAGCCATAACTTCCATAGCTGAGCACAACAGNTGGATTAAAC
JMFN032N12+ TAAAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
JMFN038N16+ G-TGGATTAAAC
JMFN014K14+ TGTCCTTAAAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
rJMFF022C21- GCAAATCTTGTCCTTAAAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
rJMFF036F01- CAGCAAATCTTGTCCTTAAAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
JMSF029H04+ GCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
JMFN018C02+ GCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
JMSF044K01+ CAGCAAATCTTGTCCTTAAAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
JMSF027K24+ AAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
                      ____________________________________________________________
consensus CAGCAAATCTTGTCCTTAAAGCCATAACTTCCATAGCTGAGCACAACAG-TGGATTAAAC
 
. : . : . : . : . : . :
rJMFF024G04- GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
rJMSF029H04- GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
rJMSF027K24- GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTGN
rJMSF044K01- GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTGN
JMFN032N12+ GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
JMFN038N16+ GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
JMFN014K14+ GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
rJMFF022C21- GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
rJMFF036F01- GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
JMSF029H04+ GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
JMFF036F01+ TGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
JMFN018C02+ GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
JMSF044K01+ GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
JMSF027K24+ GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
                      ____________________________________________________________
consensus GTGAGATCAAAGAACAAGGTTCATGTACAACACCACTCTTTAGGACTCAACAGACACTG-
 
. : . : . : . : . : . :
rJMFF024G04- TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
rJMSF029H04- TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
rJMSF027K24- TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
rJMSF044K01- NTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
JMFN032N12+ TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
JMFN038N16+ TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
JMFN014K14+ TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
rJMFF022C21- TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
rJMFF036F01- TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
JMSF029H04+ TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
JMFF036F01+ TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
JMFN018C02+ TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
JMFF022C21+ TCG
JMSF044K01+ TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
JMSF027K24+ TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
                      ____________________________________________________________
consensus TTAACTGAAAATGGCTTATTTTCGCAAAGACTAAAGTTTATTTCTTTCCTCTTAGTTTCG
 
. : . : . : . : . : . :
rJMFF024G04- CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
rJMSF029H04- CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
rJMSF027K24- CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
rJMSF044K01- CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
JMFN032N12+ CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
JMFN038N16+ CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
JMFN014K14+ CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
rJMFF022C21- CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
rJMFF036F01- CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
JMSF029H04+ CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
JMFF036F01+ CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
JMFN018C02+ CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
JMFF022C21+ CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
JMFF024G04+ CCTTTCCAGACT
JMSF044K01+ CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
JMSF027K24+ CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
                      ____________________________________________________________
consensus CACCAAGAGCCCTCTCCAATTTCGCTATTATCTGCTGATTTGGAATTGCCTTTCCAGACT
 
. : . : . : . : . : . :
rJMFF024G04- CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
rJMSF029H04- CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
rJMSF027K24- CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
rJMSF044K01- CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMFN032N12+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMFN038N16+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMFN014K14+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
rJMFF022C21- CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
rJMFF036F01- CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMSF029H04+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMFF036F01+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMFN018C02+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMFF022C21+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMFF024G04+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMSF044K01+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
JMSF027K24+ CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
                      ____________________________________________________________
consensus CGTACTCCTGAATGATTTGTGGCTTCTCATTTATGAGTTGAGCAAGTTGAGATTGGGTCA
 
. : . : . : . : . : . :
rJMFF024G04- ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
rJMSF029H04- ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
rJMSF027K24- ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
rJMSF044K01- ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMFN032N12+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMFN038N16+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMFN014K14+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
rJMFF022C21- ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
rJMFF036F01- ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMSF029H04+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMFF036F01+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMFN018C02+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMFF022C21+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMFF024G04+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMSF044K01+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
JMSF027K24+ ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
                      ____________________________________________________________
consensus ATTTCTTATCCTGCCGAGCTTGCATAATAGCTTTCTTCAATTCAGTTGGCACCTTTTGAT
 
. : . : . : . : . : . :
rJMFF024G04- GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
rJMSF029H04- GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
rJMSF027K24- GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
rJMSF044K01- GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMFN032N12+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMFN038N16+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMFN014K14+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
rJMFF022C21- GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
rJMFF036F01- GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMSF029H04+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMFF036F01+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMFN018C02+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMFF022C21+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMFF024G04+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMSF044K01+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
JMSF027K24+ GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
                      ____________________________________________________________
consensus GAGTCAGATTCTCTGTGTCTTCATCAAGTTTCCTGGTGTTCAGAGAAGTGCTACTGGAGG
 
. : . : . : . : . : . :
rJMFF024G04- CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
rJMSF029H04- CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
rJMSF027K24- CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
rJMSF044K01- CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMFN032N12+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMFN038N16+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMFN014K14+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
rJMFF022C21- CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
rJMFF036F01- CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMSF029H04+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMFF036F01+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMFN018C02+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMFF022C21+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMFF024G04+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMSF044K01+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
JMSF027K24+ CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
                      ____________________________________________________________
consensus CAGCTTTGTTTGTGCCAGCATTAGATTTCCTGATGGTTTCGATCTCGGCGCCGGAGCGAC
 
. : . : . : . : . : . :
rJMFF024G04- GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
rJMSF029H04- GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
rJMSF027K24- GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
rJMSF044K01- GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMFN032N12+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMFN038N16+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMFN014K14+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
rJMFF022C21- GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
rJMFF036F01- GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMSF029H04+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMFF036F01+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMFN018C02+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMFF022C21+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMFF024G04+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMSF044K01+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
JMSF027K24+ GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
                      ____________________________________________________________
consensus GGGCGGCGTTGACGGCTTTCTCGTCCTTGCGAGCGGCGGCGGTTGGCGCCTTCTTGCGGA
 
. : . : . : . : . : . :
rJMFF024G04- TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
rJMSF029H04- TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
rJMSF027K24- TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
rJMSF044K01- TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
JMFN032N12+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
JMFN038N16+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
JMFN014K14+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
rJMFF022C21- TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
rJMFF036F01- TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
JMSF029H04+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
JMFF036F01+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
JMFN018C02+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCC
JMFF022C21+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
JMFF024G04+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
JMSF044K01+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
JMSF027K24+ TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
                      ____________________________________________________________
consensus TCACCACGGGCTCCCAGTCTTGCGTTATCCCACTCATCTTTCTCTCTCTATCTATTCCCT
 
. : . : . : . : . : . :
rJMFF024G04- ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATT
rJMSF029H04- ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATT
rJMSF027K24- ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATTC
rJMSF044K01- ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATTC
JMFN032N12+ ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAA
JMFN038N16+ ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGG
JMFN014K14+ ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGG
rJMFF022C21- ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATT
rJMFF036F01- ACTTTTCTCTCTCTAAAGA
JMSF029H04+ ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATT
JMFF036F01+ ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATT
JMFF022C21+ ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATT
JMFF024G04+ ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATT
JMSF044K01+ ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATTC
JMSF027K24+ ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATTC
                      ____________________________________________________________
consensus ACTTTTCTCTCTCTAAAGAAGATGTTTCAGTCGGGTCGTGAACCTGAGTTGTGAGGATTC