Previous Contig 006478:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019O12Sequence536006478 (7)gb:AY045936_15614339e-39Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g782009549 (6)gb:AY045936_1561433e-107Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g
JMFF028G13Sequence521006478 (7)gb:AY045936_15614336e-37Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g141009549 (6)
JMFS115H03Sequence555006478 (7)gb:AY045936_15614332e-42Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g
JMSF009D22Sequence316006478 (7)gb:AY045936_15614339e-05Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g763009549 (6)gb:AY045936_1561433e-111Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g
JMSF027K17Sequence671006478 (7)gb:AY045936_15614337e-43Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g768009549 (6)gb:AY045936_1561433e-108Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g
JMSF034F19Sequence652006478 (7)gb:AY045936_15614331e-56Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g705009549 (6)gb:AY045936_15614335e-98Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g
JMSF040H02Sequence651006478 (7)gb:AY045936_15614331e-56Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g852009549 (6)gb:AY045936_1561433e-126Arabidopsis thaliana putative oligopeptidase A (At5g65620) mRNA, complete cds.>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040H02+ GCGAGAATCACTCAGACCATGCCAGTCAGAAGACT
JMSF034F19+ TGCGAGAATCACTCAGACCATGCCAGTCAGAAGACT
                      ____________________________________________________________
consensus TGCGAGAATCACTCAGACCATGCCAGTCAGAAGACT
 
. : . : . : . : . : . :
JMSF040H02+ CTTTGATAGCTTTAAATGCATTATAAATTGGCTTACTCTGGCCCAACCTAAGCTCAAAAG
JMSF034F19+ CTTTGATAGCTTTAAATGCATTATAAATTGGCTTACTCTGGCCCAACCTAAGCTCAAAAG
JMFS115H03+ CAAAAG
JMSF027K17+ CAAAAG
                      ____________________________________________________________
consensus CTTTGATAGCTTTAAATGCATTATAAATTGGCTTACTCTGGCCCAACCTAAGCTCAAAAG
 
. : . : . : . : . : . :
JMSF040H02+ CAACTTGTTCTGGCTGAACTTCTTCAATGGCGGAGCGGAGTTCAGGATTATCTTTCACGG
JMSF034F19+ CAACTTGTTCTGGCTGAACTTCTTCAATGGCGGAGCGGAGTTCAGGATTATCTTTCACGG
JMFS115H03+ CAACTTGTTCTGGCTGAACTTCTTCAATGGCGGAGCGGAGTTCAGGATTATCTTTCACGG
JMFF028G13+ GCGGAGTTCAGGATTATCTTTCACGG
JMFF019O12+ TTCTTCAATGGCGGAGCGGAGTTCAGGATTATCTTTCACGG
JMSF027K17+ CAACTTGTTCTGGCTGAACTTCTTCAATGGCGGAGCGGAGTTCAGGATTATCTTTCACGG
                      ____________________________________________________________
consensus CAACTTGTTCTGGCTGAACTTCTTCAATGGCGGAGCGGAGTTCAGGATTATCTTTCACGG
 
. : . : . : . : . : . :
JMSF040H02+ CCTTTAGGTGATTAACGGCGCCCCAAACCACAGCCAATTTATCAATGATCTTCTCCAATG
JMSF034F19+ CCTTTAGGTGATTAACGGCGCCCCAAACCACAGCCAATTTATCAATGATCTTCTCCAATG
JMFS115H03+ CCTTTAGGTGATTAACGGCGCCCCAAACCACAGCCAATTTATCAATGATCTTCTCCAATG
JMFF028G13+ CCTTTAGGTGATTAACGGCGCCCCAAACCACAGCCAATTTATCAATGATCTTCTCCAATG
JMFF019O12+ CCTTTAGGTGATTAACGGCGCCCCAAACCACAGCCAATTTATCAATGATCTTCTCCAATG
JMSF027K17+ CCTTTAGGTGATTAACGGCGCCCCAAACCACAGCCAATTTATCAATGATCTTCTCCAATG
                      ____________________________________________________________
consensus CCTTTAGGTGATTAACGGCGCCCCAAACCACAGCCAATTTATCAATGATCTTCTCCAATG
 
. : . : . : . : . : . :
JMSF040H02+ GCTCCACAAGCTTCGGCCACGTCGGCTCCACAGTCCTCTCTAATTCCTCCAATTCACCTT
JMSF034F19+ GCTCCACAAGCTTCGGCCACGTCGGCTCCACAGTCCTCTCTAATTCCTCCAATTCACCTT
JMFS115H03+ GCTCCACAAGCTTCGGCCACGTCGGCTCCACAGTCCTCTCTAATTCCTCCAATTCACCTT
JMFF028G13+ GCTCCACAAGCTTCGGCCACGTCGGCTCCACAGTCCTCTCTAATTCCTCCAATTCACCTT
JMFF019O12+ GCTCCACAAGCTTCGGCCACGTCGGCTCCACAGTCCTCTCTAATTCCTCCAATTCACCTT
JMSF027K17+ GCTCCACAAGCTTCGGCCACGTCGGCTCCACAGTCCTCTCTAATTCCTCCAATTCACCTT
                      ____________________________________________________________
consensus GCTCCACAAGCTTCGGCCACGTCGGCTCCACAGTCCTCTCTAATTCCTCCAATTCACCTT
 
. : . : . : . : . : . :
JMSF040H02+ CGAGCTGCTTGAGCAAAGCGCGGATTCCGGGGCGGACGTGCGAGGCGTCGATGGCATCGA
JMSF034F19+ CGAGCTGCTTGAGCAAAGCGCGGATTCCGGGGCGGACGTGCGAGGCGTCGATGGCATCGA
JMFS115H03+ CGAGCTGCTTGAGCAAAGCGCGGATTCCGGGGCGGACGTGCGAGGCGTCGATGGCATCGA
JMFF028G13+ CGAGCTGCTTGAGCAAAGCGCGGATTCCGGGGCGGACGTGCGAGGCGTCGATGGCATCGA
JMFF019O12+ CGAGCTGCTTGAGCAAAGCGCGGATTCCGGGGCGGACGTGCGAGGCGTCGATGGCATCGA
JMSF027K17+ CGAGCTGCTTGAGCAAAGCGCGGATTCCGGGGCGGACGTGCGAGGCGTCGATGGCATCGA
                      ____________________________________________________________
consensus CGAGCTGCTTGAGCAAAGCGCGGATTCCGGGGCGGACGTGCGAGGCGTCGATGGCATCGA
 
. : . : . : . : . : . :
JMSF040H02+ ACGGCGGGAAATAGAAATCCTTCAACAAAGGATTATCGTCAGTCGCGGCGGCCGCGGCCA
JMSF034F19+ ACGGCGGGAAATAGAAATCCTTCAACAAAGGATTATCGTCAGTCGCGGCGGCCGCGGCCA
JMFS115H03+ ACGGCGGGAAATAGAAATCCTTCAACAAAGGATTATCGTCAGTCGCGGCGGCCGCGGCCA
JMFF028G13+ ACGGCGGGAAATAGAAATCCTTCAACAAAGGATTATCGTCAGTCGCGGCGGCCGCGGCCA
JMFF019O12+ ACGGCGGGAAATAGAAATCCTTCAACAAAGGATTATCGTCAGTCGCGGCGGCCGCGGCCA
JMSF009D22+ CAACAAAGGATTATCGTCAGTCGCGGCGGCCGCGGCCA
JMSF027K17+ ACGGCGGGAAATAGAAATCCTTCAACAAAGGATTATCGTCAGTCGCGGCGGCCGCGGCCA
                      ____________________________________________________________
consensus ACGGCGGGAAATAGAAATCCTTCAACAAAGGATTATCGTCAGTCGCGGCGGCCGCGGCCA
 
. : . : . : . : . : . :
JMSF040H02+ TTCCGGAGACAGCAGGAGAGGGCGGGGCGGAGAATCGGCACACGGAGGTCACCCGCTTGC
JMSF034F19+ TTCCGGAGACAGCAGGAGAGGGCGGGGCGGAGAATCGGCACACGGAGGTCACCCGCTTGC
JMFS115H03+ TTCCGGAGACAGCAGGAGAGGGCGGGGCGGAGAATCGGCACACGGAGGTCACCCGCTTGC
JMFF028G13+ TTCCGGAGACAGCAGGAGAGGGCGGGGCGGAGAATCGGCACACGGAGGTCACCCGCTTGC
JMFF019O12+ TTCCGGAGACAGCAGGAGAGGGCGGGGCGGAGAATCGGCACACGGAGGTCACCCGCTTGC
JMSF009D22+ TTCCGGAGACAGCAGGAGAGGGCGGGGCGGAGAATCGGCACACGGAGGTCACCCGCTTGC
JMSF027K17+ TTCCGGAGACAGCAGGAGAGGGCGGGGCGGAGAATCGGCACACGGAGGTCACCCGCTTGC
                      ____________________________________________________________
consensus TTCCGGAGACAGCAGGAGAGGGCGGGGCGGAGAATCGGCACACGGAGGTCACCCGCTTGC
 
. : . : . : . : . : . :
JMSF040H02+ GAGGAGAAAGAGACGACGCTCGGAGTGTTGACTTGCGGGTGGTAGTGTGAAGGCAGAGTG
JMSF034F19+ GAGGAGAAAGAGACGACGCTCGGAGTGTTGACTTGCGGGTGGTAGTGTGAAGGCAGAGTG
JMFS115H03+ GAGGAGAAAGAGACGACGCTCGGAGTGTTGACTTGCGGGTGGTAGTGTGAAGGCAGAGTG
JMFF028G13+ GAGGAGAAAGAGACGACGCTCGGAGTGTTGACTTGCGGGTGGTAGTGTGAAGGCAGAGTG
JMFF019O12+ GAGGAGAAAGAGACGACGCTCGGAGTGTTGACTTGCGGGTGGTAGTGTGAAGGCAGAGTG
JMSF009D22+ GAGGAGAAAGAGACGACGCTCGGAGTGTTGACTTGCGGGTGGTAGTGTGAAGGCAGAGTG
JMSF027K17+ GAGGAGAAAGAGACGACGCTCGGAGTGTTGACTTGCGGGTGGTAGTGTGAAGGCAGAGTG
                      ____________________________________________________________
consensus GAGGAGAAAGAGACGACGCTCGGAGTGTTGACTTGCGGGTGGTAGTGTGAAGGCAGAGTG
 
. : . : . : . : . : . :
JMSF040H02+ AGAAAGAAGAAGACCAGAGGGGACAAGGGCGGGATTTAAGAAAATGATTGGGGTGAGAAA
JMSF034F19+ AGAAAGAAGAAGACCAGAGGGGACAAGGGCGGGATTTAAGAAAATGATTGGGGTGAGAAA
JMFS115H03+ AGAAAGAAGAAGACCAGAGGGGACAAGGGCGGGATTTAAGAAAATGATTGGGGTGAGAAA
JMFF028G13+ AGAAAGAAGAAGACCAGAGGGGACAAGGGCGGGATTTAAGAAAATGATTGGGGTGAGAAA
JMFF019O12+ AGAAAGAAGAAGACCAGAGGGGACAAGGGCGGGATTTAAGAAAATGATTGGGGTGAGAAA
JMSF009D22+ AGAAAGAAGAAGACCAGAGGGGACAAGGGCGGGATTTAAGAAAATGATTGGGGTGAGAAA
JMSF027K17+ AGAAAGAAGAAGACCAGAGGGGACAAGGGCGGGATTTAAGAAAATGATTGGGGTGAGAAA
                      ____________________________________________________________
consensus AGAAAGAAGAAGACCAGAGGGGACAAGGGCGGGATTTAAGAAAATGATTGGGGTGAGAAA
 
. : . : . : . : . : . :
JMSF040H02+ GGGAACGTGAGATAAACGAGGGTTTTAAGCAGAGATGCTGATAAAAGATGGGGATGGAAC
JMSF034F19+ GGGAACGTGAGATAAACGAGGGTTTTAAGCAGAGATGCTGATAAAAGATGGGGATGGAAC
JMFS115H03+ GGGAACGTGAGATAAACGAGGGTTTTAAGCAGAGATGCTGATAAAAGATGGGGATGGAAC
JMFF028G13+ GGGAACGTGAGATAAACGAGGGTTTTAAGCAGAGATGCTGATAAAAGATGGGGATGGAAC
JMFF019O12+ GGGAACGTGAGATAAACGAGGGTTTTAAGCAGAGATGCTGATAAAAGATGGGGATGGAAC
JMSF009D22+ GGGAACGTGAGATAAACGAGGGTTTTAAGCAGAGATGCTGATAAAAGATGGGGATGGAAC
JMSF027K17+ GGGAACGTGAGATAAACGAGGGTTTTAAGCAGAGATGCTGATAAAAGATGGGGATGGAAC
                      ____________________________________________________________
consensus GGGAACGTGAGATAAACGAGGGTTTTAAGCAGAGATGCTGATAAAAGATGGGGATGGAAC
 
. : . : . : . : . : . :
JMSF040H02+ GAGCAGGCGAAAAAC
JMSF034F19+ GAGCAGGCGAAAAAC
JMFS115H03+ GAGCAGGCG
JMFF028G13+ GAGCAGGCGAAAAAC
JMFF019O12+ GAGCAGGCGAAAAAC
JMSF009D22+ GAGCAGGCGAAAAACAGGCCGCCATGAAAATGAGGAT
JMSF027K17+ GAGCAGGCGAAAAACAGGCCGCCATGAAAATGAGGATGTATATAAGTAGCGAGGGAGGAG
                      ____________________________________________________________
consensus GAGCAGGCGAAAAACAGGCCGCCATGAAAATGAGGATGTATATAAGTAGCGAGGGAGGAG
 
. : . : . : . : . : . :
JMSF027K17+ TATTATAACCGCAACTGGTTCCCGATGGCGTATCCGTATCGGATAAACTTGTTGGACGTC
                      ____________________________________________________________
consensus TATTATAACCGCAACTGGTTCCCGATGGCGTATCCGTATCGGATAAACTTGTTGGACGTC