Previous Contig 006473:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS009H12Sequence594006473 (6)gb:AF362949_17915104e-44Nicotiana tabacum endo-beta-1,4-glucanase precursor (Cel8) mRNA, complete cds.
JMFS065A10Sequence589006473 (6)gb:AF098292_17679122e-64Lycopersicon esculentum endo-beta-1,4-D-glucanase (Cel8) mRNA, complete cds.
JMFS065A12Sequence618006473 (6)gb:AF098292_17679121e-71Lycopersicon esculentum endo-beta-1,4-D-glucanase (Cel8) mRNA, complete cds.
JMFS154D01Sequence613006473 (6)gb:AF098292_17679124e-81Lycopersicon esculentum endo-beta-1,4-D-glucanase (Cel8) mRNA, complete cds.
JMSF006F02Sequence412006473 (6)gb:AF362949_17915101e-24Nicotiana tabacum endo-beta-1,4-glucanase precursor (Cel8) mRNA, complete cds.
JMSF027J19Sequence552006473 (6)gb:AF362949_17915103e-32Nicotiana tabacum endo-beta-1,4-glucanase precursor (Cel8) mRNA, complete cds.764012557 (2)gb:AF362949_17915109e-30Nicotiana tabacum endo-beta-1,4-glucanase precursor (Cel8) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS154D01+ GTCTCGCCGGCGAGGTCGGA
                      ____________________________________________________________
consensus GTCTCGCCGGCGAGGTCGGA
 
. : . : . : . : . : . :
JMFS154D01+ TCCGGGGTGGCTGGGGTCGATCTTGTAGGCGGTTCTTGAAGTGGTCATGTCTTCCGGCCT
JMFS065A12+ GGTTCTTGAAGTGGTCATGTCTTCCGGCCT
                      ____________________________________________________________
consensus TCCGGGGTGGCTGGGGTCGATCTTGTAGGCGGTTCTTGAAGTGGTCATGTCTTCCGGCCT
 
. : . : . : . : . : . :
JMFS154D01+ TTGCCAACAATAGTGGTCGGTGTTCCCATCCCCCACCTCTCCATAAAGGACATCAGGTTG
JMFS065A12+ TTGCCAACAATAGTGGTCGGTGTTCCCATCCCCCACCTCTCCATAAAGGACATCAGGTTG
JMFS065A10+ CAACAATAGTGGTCGGTGTTCCCATCCCCCACCTCTCCATAAAGGACATCAGGTTG
                      ____________________________________________________________
consensus TTGCCAACAATAGTGGTCGGTGTTCCCATCCCCCACCTCTCCATAAAGGACATCAGGTTG
 
. : . : . : . : . : . :
JMFS154D01+ AGGGTGAGCTTTGATGAGATAATCAGTGCCCCACTTGATAGCATCCATGGCGTGGCTAAG
JMFS065A12+ AGGGTGAGCTTTGATGAGATAATCAGTGCCCCACTTGATAGCATCCATGGCGTGGCTAAG
JMFS065A10+ AGGGTGAGCTTTGATGAGATAATCAGTGCCCCACTTGATAGCATCCATGGCGTGGCTAAG
JMFS009H12+ AGATAATCAGTGCCCCACTTGATAGCATCCATGGCG-GGCTAAG
                      ____________________________________________________________
consensus AGGGTGAGCTTTGATGAGATAATCAGTGCCCCACTTGATAGCATCCATGGCGTGGCTAAG
 
. : . : . : . : . : . :
JMFS154D01+ CTGCCCACTGGCACCCATTTGCCTTCCATATTCTATGATGCTCCACGACATCATGGTAAC
JMFS065A12+ CTGCCCACTGGCACCCATTTGCCTTCCATATTCTATGATGCTCCACGACATCATGGTAAC
JMFS065A10+ CTGCCCACTGGCACCCATTTGCCTTCCATATTCTATGATGCTCCACGACATCATGGTAAC
JMFS009H12+ CTGCCCACTGGCACCCATTTGCCTTCCATATTCTATGATGCTCCACGACATCATGGTAAC
JMSF027J19+ CATCATGGTAAC
                      ____________________________________________________________
consensus CTGCCCACTGGCACCCATTTGCCTTCCATATTCTATGATGCTCCACGACATCATGGTAAC
 
. : . : . : . : . : . :
JMFS154D01+ GGTGAACGCCATTGGAAGCCCAAATTTCACGTTGTCCCCGGCATCATAGTACCCTCCAAT
JMFS065A12+ GGTGAACGCCATTGGAAGCCCAAATTTCACGTTGTCCCCGGCATCATAGTACCCTCCAAT
JMFS065A10+ GGTGAACGCCATTGGAAGCCCAAATTTCACGTTGTCCCCGGCATCATAGTACCCTCCAAT
JMSF006F02+ TTCACGTTGTCCCNGGCATCATAGTACCCTCCAAT
JMFS009H12+ GGTGAACGCCATTGGAAGCCCAAATTTCACGTTGTCCCCGGCATCATAGTACCCTCCAAT
JMSF027J19+ GGTGANCGCCATTGGAAGCCCAAATTTCACGTTGTCCCCGGCATCATAGTACCCTCCAAT
                      ____________________________________________________________
consensus GGTGAACGCCATTGGAAGCCCAAATTTCACGTTGTCCCCGGCATCATAGTACCCTCCAAT
 
. : . : . : . : . : . :
JMFS154D01+ CAGATCCACCCCACTAGCTTTGCCATCAAGGAGCCCAGAATTTCCCCTCCATTGAACTCT
JMFS065A12+ CAGATCCACCCCACTAGCTTTGCCATCAAGGAGCCCAGAATTTCCCCTCCATTGAACTCT
JMFS065A10+ CAGATCCACCCCACTAGCTTTGCCATCAAGGAGCCCAGAATTTCCCCTCCATTGAACTCT
JMSF006F02+ CAGATCCACCCCACTAGCTTTGCCATCAAGGAGCCCAGAATTTCCCCTCCATTGAACTCT
JMFS009H12+ CAGATCCACCCCACTAGCTTTGCCATCAAGGAGCCCAGAATTTCCCCTCCATTGAACTCT
JMSF027J19+ CAGATCCACCCCACTAGCTTTGCCATCAAGGAGCCCAGAATTTCCCCTCCATTGAACTCT
                      ____________________________________________________________
consensus CAGATCCACCCCACTAGCTTTGCCATCAAGGAGCCCAGAATTTCCCCTCCATTGAACTCT
 
. : . : . : . : . : . :
JMFS154D01+ CTGGGTATGGGGGAGATACCCAGATCTCTGAGCTTCATAGAACAGGAAGCTCTTGCTCAG
JMFS065A12+ CTGGGTATGGGGGAGATACCCAGATCTCTGAGCTTCATAGAACAGGAAGCTCTTGCTCAG
JMFS065A10+ CTGGGTATGGGGGAGATACCCAGATCTCTGAGCTTCATAGAACAGGAAGCTCTTGCTCAG
JMSF006F02+ CTGGGTATGGGGGAGATACCCAGATCTCTGAGCTTCATAGAACAGGAAGCTCTTGCTCAG
JMFS009H12+ CTGGGTATGGGGGAGATACCCAGATCTCTGAGCTTCATAGAACAGGAAGCTCTTGCTCAG
JMSF027J19+ CTGGGTATGGGGGAGATACCCAGATCTCTGAGCTTCATAGAACAGGAAGCTCTTGCTCAG
                      ____________________________________________________________
consensus CTGGGTATGGGGGAGATACCCAGATCTCTGAGCTTCATAGAACAGGAAGCTCTTGCTCAG
 
. : . : . : . : . : . :
JMFS154D01+ AGCTTCAGCATAATCATGGCCGCCCATTGCCACACAAGGAAGAACAACCACAACCCCCAC
JMFS065A12+ AGCTTCAGCATAATCATGGCCGCCCATTGCCACACAAGGAAGAACAACCACAACCCCCAC
JMFS065A10+ AGCTTCAGCATAATCATGGCCGCCCATTGCCACACAAGGAAGAACAACCACAACCCCCAC
JMSF006F02+ AGCTTCAGCATAATCATGGCCGCCCATTGCCACACAAGGAAGAACAACCACAACCCCCAC
JMFS009H12+ AGCTTCAGCATAATCATGGCCGCCCATTGCCACACAAGGAAGAACAACCACAACCCCCAC
JMSF027J19+ AGCTTCAGCATAATCATGGCCGCCCATTGCCNCACAAGGAAGAACAACCACAACCCCCAC
                      ____________________________________________________________
consensus AGCTTCAGCATAATCATGGCCGCCCATTGCCACACAAGGAAGAACAACCACAACCCCCAC
 
. : . : . : . : . : . :
JMFS154D01+ CAACAAAAACACAATTCTCTCCATACTTCTTAAACCAGATCTGTTCTGTAAGGCTATATA
JMFS065A12+ CAACAAAAACACAATTCTCTCCATACTTCTTAAACCAGATCTGTTCTGTAAGGCTATATA
JMFS065A10+ CAACAAAAACACAATTCTCTCCATACTTCTTAAACCAGATCTGTTCTGTAAGGCTATATA
JMSF006F02+ CAACAAAAACACAATTCTCTCCATACTTCTTAAACCAGATCTGTTCTGTAAGGCTATATA
JMFS009H12+ CAACAAAAACACAATTCTCTCCATACTTCTTAAACCAGATCTGTTCTGTAAGGCTATATA
JMSF027J19+ CAACAAAAACACAATTCTCTCCATACTTCTTAAACCAGATCTGTTCTGTAAGGCTATATA
                      ____________________________________________________________
consensus CAACAAAAACACAATTCTCTCCATACTTCTTAAACCAGATCTGTTCTGTAAGGCTATATA
 
. : . : . : . : . : . :
JMFS154D01+ TAGCAGTATATGTATATATATGTGTGTATGAACAAAATGGCTAATGCTGCTTT
JMFS065A12+ TAGCAGTATATGTATATATATGTGTGTATGAACAAAATGGCTAATGCTGCTTTGTTTATC
JMFS065A10+ TAGCAGTATATGTATATATATGTGTGTATGAACAAAATGGCTAATGCTGCTTTGTTTATC
JMSF006F02+ TAGCAGTATATGTATATATATGTGTGTATGAACAAAATGGCTAATGCTGCTTTGTTTATC
JMFS009H12+ TAGCAGTATATGTATATATATGTGTGTATGAACAAAATGGCTAATGCTGCTTTGTTTATC
JMSF027J19+ TAGCAGTATATGTATATATATGTGTGTATGAACAAAATGGCTAATGCTGCTTTGTTTATC
                      ____________________________________________________________
consensus TAGCAGTATATGTATATATATGTGTGTATGAACAAAATGGCTAATGCTGCTTTGTTTATC
 
. : . : . : . : . : . :
JMFS065A12+ AGCTAAAACTTGTGATAAACTCCACAAAGAACAGAGCAGAGAAAGGGA
JMFS065A10+ AGCTAAAACTTGTGATAAACTCCACAAAGAACAGAGCAGAGAAAGGGAGAAAA
JMSF006F02+ AGCTAAAACTTGTGATAAACTCCACAAAGAACAGAGCAGAGAAAGGGAGAAAAGAGAGAA
JMFS009H12+ AGCTAAAACTTGTGATAAACTCCACAAAGAACAGAGCAGAGAAAGGGAGAAAAGAGAGAA
JMSF027J19+ AGCTAAAACTTGTGATAAACTCCACAAAGAACAGAGCAGAGAAAGGGAGAAAAGAGAGAA
                      ____________________________________________________________
consensus AGCTAAAACTTGTGATAAACTCCACAAAGAACAGAGCAGAGAAAGGGAGAAAAGAGAGAA
 
. : . : . : . : . : . :
JMSF006F02+ AGAGGAGGCTGGGA
JMFS009H12+ AGAGGAGGCTGGGATTGAGGGAAGAAGATGGAGCTTGAGTTTACTATATATGGTGGAGGG
JMSF027J19+ AGAGGAGGCTGGGATTGAGGGAAGAAGATGGAGCTTGAGTTTACTATATATGGTGGAGGG
                      ____________________________________________________________
consensus AGAGGAGGCTGGGATTGAGGGAAGAAGATGGAGCTTGAGTTTACTATATATGGTGGAGGG
 
. : . : . : . : . : . :
JMFS009H12+ AGTAGGATGGT
JMSF027J19+ AGTAGGATGGTGCCAATACAGCAGAATGGTAAGTGATCTAACAAATTTCAAAATCTTATC
                      ____________________________________________________________
consensus AGTAGGATGGTGCCAATACAGCAGAATGGTAAGTGATCTAACAAATTTCAAAATCTTATC