Previous Contig 006472:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006I10Sequence531006472 (40)sp|P10708|CB12_LYCES2e-66Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p705006472 (40)sp|P10708|CB12_LYCESe-106Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFF007O23Sequence561006472 (40)sp|P10708|CB12_LYCES1e-74Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p524006472 (40)sp|P13869|CB12_PETHY3e-76Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB).>pir|S
JMFF017J18Sequence592006472 (40)sp|P10708|CB12_LYCES1e-79Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p774006472 (40)sp|P10708|CB12_LYCESe-124Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFF022L08Sequence727006472 (40)sp|P10708|CB12_LYCESe-113Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFF023C11Sequence481006472 (40)sp|P10708|CB12_LYCES3e-55Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p757006472 (40)sp|P10708|CB12_LYCESe-126Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFF028B03Sequence534006472 (40)sp|P10708|CB12_LYCES2e-67Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p556006472 (40)sp|P13869|CB12_PETHY1e-71Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB).>pir|S
JMFF028B04Sequence535006472 (40)sp|P10708|CB12_LYCES2e-67Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p527006472 (40)sp|P13869|CB12_PETHY6e-66Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB).>pir|S
JMFF048E17Sequence478006472 (40)sp|P10708|CB12_LYCES2e-57Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p286006472 (40)pir|S60608|S606087e-13chlorophyll a/b-binding protein type II precursor, photosystem I - garden pea>gb
JMFN001C07Sequence525006472 (40)sp|P10708|CB12_LYCES4e-65Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFN002C06Sequence597006472 (40)sp|P10708|CB12_LYCES3e-74Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFN003B23Sequence567006472 (40)sp|P13869|CB12_PETHY1e-77Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB).>pir|S
JMFN009F07Sequence618006472 (40)sp|P10708|CB12_LYCES2e-90Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFN010C05Sequence512006472 (40)sp|P10708|CB12_LYCES4e-65Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFN013A06Sequence623006472 (40)sp|P13869|CB12_PETHY2e-75Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB).>pir|S
JMFN018L03Sequence313006472 (40)sp|P10708|CB12_LYCES2e-10Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFN018L13Sequence603006472 (40)sp|P10708|CB12_LYCES1e-78Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFN030B12Sequence621006472 (40)sp|P10708|CB12_LYCES6e-99Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFN032A10Sequence448006472 (40)pir|T47939|T479399e-50Lhca2 protein - Arabidopsis thaliana>gb:ATF2A19_1550422 Arabidopsis thaliana DNA
JMFN034E23Sequence482006472 (40)sp|P13869|CB12_PETHY1e-57Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB).>pir|S
JMFN037O13Sequence597006472 (40)sp|P10708|CB12_LYCES3e-98Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMFS036D08Sequence590006472 (40)sp|P13869|CB12_PETHY3e-91Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB).>pir|S
JMFS058H05Sequence603006472 (40)sp|P13869|CB12_PETHY1e-90Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB).>pir|S
JMFS059G11Sequence627006472 (40)sp|P13869|CB12_PETHY1e-90Chlorophyll a-b binding protein, chloroplast precursor (LHCI type II CAB).>pir|S
JMFS059G12Sequence580006472 (40)sp|P10708|CB12_LYCES2e-64Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMSF005A20Sequence316006472 (40)sp|P10708|CB12_LYCES2e-27Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p204002036 (45)pir|JQ1286|JQ12860.002glyceraldehyde-3-phosphate dehydrogenase (NADP) (phosphorylating) (EC 1.2.1.13)
JMSF027J17Sequence684006472 (40)sp|P10708|CB12_LYCES1e-98Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p736006472 (40)sp|P10708|CB12_LYCESe-123Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMSF030C13Sequence659006472 (40)sp|P10708|CB12_LYCES4e-93Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p747006472 (40)sp|P10708|CB12_LYCESe-121Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMSF039H09Sequence628006472 (40)sp|P10708|CB12_LYCES8e-86Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p819006472 (40)sp|P10708|CB12_LYCESe-133Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p
JMSF048L21Sequence688006472 (40)sp|P10708|CB12_LYCES1e-98Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p682006472 (40)sp|P10708|CB12_LYCESe-122Chlorophyll a-b binding protein 7, chloroplast precursor (LHCI type II CAB-7).>p

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN003B23+ G
rJMFF028B04- TTCCGAAGTTG
JMFN034E23+ AGGTTCCGAAGTTG
rJMFF028B03- AGGTTCCGAAGTTG
JMFN032A10+ AGGTTCCGAAGTTG
rJMFF048E17- AGGGCCTGGATTATTAGGTTCCGAAGTTG
JMFN013A06+ TGGGAAATTTAAATTAGGGCCTGGATTATTAGGTTCCGAAGTTG
                      ____________________________________________________________
consensus TGGGAAATTTAAATTAGGGCCTGGATTATTAGGTTCCGAAGTTG
 
. : . : . : . : . : . :
JMFN003B23+ CGAGAGCTTA-AAGTATTTGTACACACTGCATAATCTTTTCTACATCAGACAAAGACTGA
rJMFF028B04- CGAGAGCTTATAAGTATTTGTACACACTGCNTAATCTTTTCTACATCAGACAAAGACTGA
JMFN034E23+ CGAGAGCTTA-AAGTATTTGTACACACTGCATAATCTTTTCTACATCAGACAAAGACTGA
rJMFF028B03- CGAGAGCTTA-AAGTATTTGTACACACTGCATAATCTTTTCTACATCAGACAAAGACTGA
JMFN032A10+ CGAGAGCTTA-AAGTATTTGTACACACTGCATAATCTTTTCTACATCAGACAAAGACTGA
rJMFF048E17- CGAAAGCTTA-AAGTATTTGTACACACTGCATAATCTTTTCTACATCAAACAAAGACTGA
JMFN013A06+ CGAGAGCTTA-AAGTATTTGTACACACTGCATAATCTTTTCTACATCAGACAAAGACTGA
JMFS059G11+ GCTTA-AAGTATTTGTACACACTGCATAATCTTTTCTACATCAGACAAAGACTGA
JMFS058H05+ ATAATCTTTTCTACATCAGACAAAGACTGA
JMFN030B12+ CTGA
JMFS059G12+ CTGA
JMFS036D08+ ACAAAGACTGA
rJMFF022L08- TCAGACAAAGACTGA
rJMSF030C13- TTTCTACATCAGACAAAGACTGA
rJMFF006I10- ATCTTTTCTACATCAGACAAAGACTGA
rJMFF007O23- ATCTTTTCTAC-TCAGAC-AAGACTGA
rJMFF017J18- ATCTTTTCTAC-TCAGACAAAGACTGA
                      ____________________________________________________________
consensus CGAGAGCTTA-AAGTATTTGTACACACTGCATAATCTTTTCTACATCAGACAAAGACTGA
 
. : . : . : . : . : . :
JMFN003B23+ AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMFF028B04- AGGANCATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
JMFN034E23+ AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMFF028B03- AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
JMFN032A10+ AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMFF048E17- AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
JMFN013A06+ AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
JMFS059G11+ AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
JMFS058H05+ AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
JMFN030B12+ AGGAACATGATGGTATTCATACAACATATGATCGAACAAATAATTGTCAAATTCTTGCTC
JMFS059G12+ AGGAACATGATTGTATTCATACAACATATGATCGCACACATAATTGTCAATCTCGTGCTG
JMFS036D08+ AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMFF022L08- AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMSF030C13- AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMFF006I10- AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMFF007O23- AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMFF017J18- AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMSF048L21- AATTCTTGCTC
rJMFF023C11- ATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMSF027J17- ATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
rJMSF039H09- CATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
                      ____________________________________________________________
consensus AGGAACATGATTGTATTCATACAACATATGATCGGACAAATAATTGTCAAATTCTTGCTC
 
. : . : . : . : . : . :
JMFN003B23+ TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMFF028B04- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
JMFN034E23+ TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMFF028B03- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
JMFN032A10+ TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMFF048E17- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
JMFN013A06+ TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
JMFS059G11+ TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
JMFS058H05+ TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
JMFN030B12+ TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
JMFS059G12+ TAAGACGTTTCTCAGCAGCTCGAGACTTTTCTTCTCACTTGGGAGTGAAACCAGCAGCAA
JMFS036D08+ TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMFF022L08- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMSF030C13- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMFF006I10- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMFF007O23- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMFF017J18- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMSF048L21- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMFF023C11- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMSF027J17- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
rJMSF039H09- TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
                      ____________________________________________________________
consensus TAAGACGTTCTTCAGCAGCTCGATACTTTTCTTCTCACTTGGGAGTGAAAGCAGCAAAAA
 
. : . : . : . : . : . :
JMFN003B23+ CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMFF028B04- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
JMFN034E23+ CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMFF028B03- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
JMFN032A10+ CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMFF048E17- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
JMFN013A06+ CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
JMFS059G11+ CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
JMFS058H05+ CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
JMFN030B12+ CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
JMFS059G12+ CAGTGGCGTGGCCGGGATCACCCAGGTGAGCAAAGAGCTTGTTGATTGGTCCTGATCCGG
JMFS036D08+ CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMFF022L08- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMSF030C13- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMFF006I10- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMFF007O23- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMFF017J18- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMSF048L21- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMFF023C11- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMSF027J17- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
rJMSF039H09- CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
                      ____________________________________________________________
consensus CAGTGGCGTGACCGGGATCAGCCAGGTGAGCAAAGAGGTTGTCGATTGGTCCTGTTCCGG
 
. : . : . : . : . : . :
JMFN003B23+ TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMFF028B04- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
JMFN034E23+ TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMFF028B03- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
JMFN032A10+ TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMFF048E17- TGTAGATGTGTTGGAACC
JMFN013A06+ TGTAGA--TGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
JMFS059G11+ TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
JMFS058H05+ TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
JMFN030B12+ TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
JMFS059G12+ TGTAGATGTGTCGGAGCCATGCGCCCATAACTGCCAGCATGGATAATCTTCCGTTATTGA
JMFS036D08+ TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMFF022L08- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMSF030C13- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMFF006I10- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMFF007O23- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMFF017J18- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMSF048L21- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMFF023C11- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMSF027J17- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
rJMSF039H09- TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
                      ____________________________________________________________
consensus TGTAGATGTGTTGGAACCATGCGCCCATAACTGCCAGCATGGCTAATCTTCCGTTCTTGA
 
. : . : . : . : . : . :
JMFN003B23+ TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMFF028B04- TCTCCCTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
JMFN034E23+ TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMFF028B03- TCTCCCTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
JMFN032A10+ TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
JMFN013A06+ TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
JMFS059G11+ TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
JMFS058H05+ TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
JMFN030B12+ TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
JMFS059G12+ TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCATCAGAGTGGGT
JMFS036D08+ TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMFF022L08- TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMSF030C13- TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMFF006I10- TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMFF007O23- TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMFF017J18- TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMSF048L21- TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMFF023C11- TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMSF027J17- TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
rJMSF039H09- TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
JMSF048L21+ TTCGGGAGAACCAGATCCCCAACCGAGTGGGT
JMSF030C13+ GGT
JMFN037O13+ ACCAGATCCCCAACCGAGTGGGT
JMSF027J17+ GGAGAACCAGATCCCCAACCGAGTGGGT
                      ____________________________________________________________
consensus TCTCCTTGGTTCTCAACTCCTTGATCTTTTCGGGAGAACCAGATCCCCAACCGAGTGGGT
 
. : . : . : . : . : . :
JMFN003B23+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMFF028B04- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFN034E23+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMFF028B03- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFN032A10+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFN013A06+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFS059G11+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFS058H05+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFN030B12+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFS059G12+ GCATCCATAAGCCGCATGAATAGCATACGTCAGTCCCGGTGAGCTTGTTGTTGGGAAAGA
JMFS036D08+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMFF022L08- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMSF030C13- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMFF006I10- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMFF007O23- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMFF017J18- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMSF048L21- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMFF023C11- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMSF027J17- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
rJMSF039H09- CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMSF048L21+ CGAACCATAAGCCACCTGGATAGCNTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMSF039H09+ GTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFN009F07+ CATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFF017J18+ GGGGAAGA
JMFN018L13+ AAGA
JMSF030C13+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFN037O13+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
JMFN002C06+ CTACGTCAGTCCCGGTGAGCTTGTTG-TGGGNAAGA
JMSF027J17+ CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
                      ____________________________________________________________
consensus CGAACCATAAGCCACCTGGATAGCCTACGTCAGTCCCGGTGAGCTTGTTGTTGGGGAAGA
 
. : . : . : . : . : . :
JMFN003B23+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMFF028B04- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFN034E23+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCT
rJMFF028B03- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFN032A10+ TGGGGTCCGTGTTCA
JMFN013A06+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFS059G11+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFS058H05+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFN030B12+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFS059G12+ TGCGGTCAGTGCTCACGCATCCAGGCTCCATGATGTTTGCCCCCCGCCTTCCCTCAGCCC
JMFS036D08+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMFF022L08- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMSF030C13- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMFF006I10- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMFF007O23- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMFF017J18- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMSF048L21- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMFF023C11- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMSF027J17- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
rJMSF039H09- TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMSF048L21+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMSF039H09+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFN009F07+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFF017J18+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCNTTCCCTCAGCCC
JMFN018L13+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTNTGCCCACCGCCTTCCCTCAGCCC
JMFF007O23+ TTCACGCATCCAGGCTTGATGATGTNTGCCCACCGCNTTCCCTCAGCCC
JMFN001C07+ C
JMFF028B03+ CCCTCAGCCC
JMFF028B04+ TCCCTCAGCCC
JMSF030C13+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFN037O13+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
JMFN002C06+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTNTGCCCACCGCCTTCCCTCAGCCC
JMFF006I10+ TCAGCCC
JMSF027J17+ TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
                      ____________________________________________________________
consensus TGGGGTCCGTGTTCACGCATCCAGGCTTGATGATGTCTGCCCACCGCCTTCCCTCAGCCC
 
. : . : . : . : . : . :
JMFN003B23+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMFF028B04- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGG
rJMFF028B03- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFN013A06+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFS059G11+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFS058H05+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFN030B12+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFS059G12+ AGCCGATGAGTATCAACTCGATGTCAAAGAGCCGTGGTTGCATCGGTTAAGTCCTCTTGT
JMFS036D08+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMFF022L08- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMSF030C13- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMFF006I10- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMFF007O23- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMFF017J18- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMSF048L21- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMFF023C11- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMSF027J17- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
rJMSF039H09- AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMSF048L21+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMSF039H09+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFN009F07+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFF017J18+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFN018L13+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFF007O23+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFN001C07+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFN010C05+ GCCGATGAGTATCAACTCGATGACAAAGAG-AGTGGTTGTATCGGTGAAGTACTCTTGT
JMFF048E17+ GAAGTACTCTTGT
JMFF028B03+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFF028B04+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFF023C11+ CTTGT
JMSF030C13+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFN037O13+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFN002C06+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMFF006I10+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
JMSF027J17+ AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
                      ____________________________________________________________
consensus AGCCGATGAGTATCAACTCGATGACAAAGAG-CGTGGTTGTATCGGTGAAGTACTCTTGT
 
. : . : . : . : . : . :
JMFN003B23+ TCGCCCGCAGTGTACCACGAAGGCGTGT
rJMFF028B03- TCG
JMFN013A06+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCT
JMFS059G11+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFS058H05+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFN030B12+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFS059G12+ TCGCCCTCAGTGTACCACCAAGGAGTGTTCAGAATCCCGATCTTGGTGAGTATCTCCGGC
JMFS036D08+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
rJMFF022L08- TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
rJMSF030C13- TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
rJMFF006I10- TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGAGAGGAACTCCGGG
rJMFF007O23- TCGCCCGCAGTGTACCACGA
rJMFF017J18- TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGAGAGGAACTCCGGG
rJMSF048L21- TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
rJMFF023C11- TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
rJMSF027J17- TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
rJMSF039H09- TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMSF048L21+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMSF039H09+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFN009F07+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFF017J18+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGAGAGGAACTCCGGG
JMFN018L13+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFF007O23+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFN001C07+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFN010C05+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFF048E17+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFF028B03+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFF028B04+ TCGCCNGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATTTTCGTGAGGAACTCCGGG
JMFF023C11+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMSF030C13+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFN037O13+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFN002C06+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
JMFF006I10+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGAGAGGAACTCCGGG
JMSF027J17+ TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
                      ____________________________________________________________
consensus TCGCCCGCAGTGTACCACGAAGGCGTGTTCAGAATCCCGATCTTCGTGAGGAACTCCGGG
 
. : . : . : . : . : . :
JMFS059G11+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATC
JMFS058H05+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATC
JMFN030B12+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFS059G12+ ATGAAAAGACCCGCAGCCCCCAACATCGCCCATCT
JMFS036D08+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCT
rJMFF022L08- ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
rJMSF030C13- ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
rJMFF006I10- ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
rJMFF017J18- ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
rJMSF048L21- ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
rJMFF023C11- ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
rJMSF027J17- ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
rJMSF039H09- ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMSF048L21+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMSF039H09+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFN009F07+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFF017J18+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFN018L13+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFF007O23+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFN001C07+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFN010C05+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFF048E17+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFF028B03+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFF028B04+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATNTGCAGTGCACAATCTCCGCCTGCTGG
JMFF023C11+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMSF030C13+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFN037O13+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFN002C06+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMFF006I10+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
JMSF027J17+ ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
                      ____________________________________________________________
consensus ATGAAAATACCCGCAGCCCCCAACATCGCCCATCTGCAGTGCACAATCTCCGCCTGCTGG
 
. : . : . : . : . : . :
JMFN030B12+ TTCCATTTCAAGCTCTCG
rJMFF022L08- TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
rJMSF030C13- TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
rJMFF006I10- TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACCNAAAGTCTCC
rJMFF017J18- TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
rJMSF048L21- TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
rJMFF023C11- TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
rJMSF027J17- TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAATCTCC
rJMSF039H09- TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMSF048L21+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMSF039H09+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFN009F07+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFF017J18+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFN018L13+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFF007O23+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFN001C07+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFN010C05+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFF048E17+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFF028B03+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFF028B04+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFF023C11+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMSF030C13+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFN037O13+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFN002C06+ TTCCATTTC-AGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMSF005A20+ TCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMFN018L03+ CGGGATCAGATGCAAGACCAAGGGGATCANAACC-ANAGTCTCC
JMFF006I10+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
JMSF027J17+ TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAATCTCC
                      ____________________________________________________________
consensus TTCCATTTCAAGCTCTCGGGATCAGATGCAAGACCAAGGGGATCAAAACC-AAAGTCTCC
 
. : . : . : . : . : . :
rJMFF022L08- AGGGANGCTGCCATCGAGCCATGGAAGGANGGGTGCTGCCCGG
rJMSF030C13- AGGGAGGCTGCCATCGAGCCATGG-AGGANGGGTGCTGCCCGGGAACCANAGGGGTCGGT
rJMFF006I10- AGGGAGGCTGCCATCGAGC
rJMFF017J18- AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAAGGGTCGGT
rJMSF048L21- AGGGAGGCTGCCATCGAGCCATGG-AGGANGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
rJMFF023C11- AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
rJMSF027J17- AGGGAGGCTGCCATCGAGCCATGG-AGGANGGGTGCTGCCCGGGAACCANANGGGTCGGT
rJMSF039H09- AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMSF048L21+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMSF039H09+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFN009F07+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFF017J18+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFN018L13+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFF007O23+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFN001C07+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFN010C05+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFF048E17+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFF028B03+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFF028B04+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFF023C11+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMSF030C13+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFN037O13+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFN002C06+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMSF005A20+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFN018L03+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMFF006I10+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
JMSF027J17+ AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
                      ____________________________________________________________
consensus AGGGAGGCTGCCATCGAGCCATGG-AGGAGGGGTGCTGCCCGGGAACCAGAGGGGTCGGT
 
. : . : . : . : . : . :
rJMSF030C13- TGGGC
rJMFF017J18- TGGGCTCAGCCGTAGCACAAACCGTAAAAG
rJMSF048L21- TGGGCTCAGCCGTA
rJMFF023C11- TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCANGGGGCCGAGTACTTG
rJMSF027J17- TGGGCTCAGCCGTAGCACAAACCGT
rJMSF039H09- TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMSF048L21+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMSF039H09+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFN009F07+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFF017J18+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFN018L13+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFF007O23+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFN001C07+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFN010C05+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFF048E17+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFF028B03+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFF028B04+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFF023C11+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMSF030C13+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFN037O13+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFN002C06+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMSF005A20+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFN018L03+ TGGGCTCAGCTGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMFF006I10+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
JMSF027J17+ TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
                      ____________________________________________________________
consensus TGGGCTCAGCCGTAGCACAAACCGTAAAAGATCGCGACGTGGCA-GGGGCCGAGTACTTG
 
. : . : . : . : . : . :
rJMFF023C11- CTCAC
rJMSF039H09- CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAA
JMSF048L21+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMSF039H09+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFN009F07+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFF017J18+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFN018L13+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFF007O23+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFN001C07+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFN010C05+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFF048E17+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFF028B03+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFF028B04+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFF023C11+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMSF030C13+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFN037O13+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFN002C06+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMSF005A20+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCG-ACTCGGGGACGAG
JMFN018L03+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMFF006I10+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
JMSF027J17+ CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
                      ____________________________________________________________
consensus CTCACCCTCAGTTTTCTCCCCGAGAGGAAAGACGCCTTTGTCTGCGAACTCGGGGACGAG
 
. : . : . : . : . : . :
JMSF048L21+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMSF039H09+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFN009F07+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFF017J18+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFN018L13+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFF007O23+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFN001C07+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFN010C05+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFF048E17+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFF028B03+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFF028B04+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFF023C11+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMSF030C13+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFN037O13+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGC
JMFN002C06+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMSF005A20+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFN018L03+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMFF006I10+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
JMSF027J17+ AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
                      ____________________________________________________________
consensus AATGCAGCGGCCGCAATGGTGGACGAAGCAGCACAGGCAGACACCATGTCGACAGATTTC
 
. : . : . : . : . : . :
JMSF048L21+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGTGAGAAAGGCTTC
JMSF039H09+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGTGAGAAAGGCTTC
JMFN009F07+ GAGCTGTACAATGCAGGGTGGGTGTGA
JMFF017J18+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGT
JMFN018L13+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGT
JMFF007O23+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGT
JMFN001C07+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGT
JMFN010C05+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTG
JMFF048E17+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGT
JMFF028B03+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGT
JMFF028B04+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGT
JMFF023C11+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGTGAGAAAGGCTT
JMSF030C13+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGTGAGAAAGGCTTC
JMFN002C06+ GAGCTGTACAATGCAGGGTGGGTGTGA
JMSF005A20+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCT
JMFN018L03+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCT
JMFF006I10+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGT
JMSF027J17+ GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGTGAGAAAGGCTTC
                      ____________________________________________________________
consensus GAGCTGTACAATGCAGGGTGGGTGTGATTGCTGTGTGGGGAAAGAAGTGAGAAAGGCTTC