Previous Contig 006462:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF027I07Sequence684006462 (2)gb:AY058855_15643921e-32Arabidopsis thaliana AT3g20680/F3H11_7 mRNA, complete cds.>gb:AY143863_1583320 A771012552 (3)gb:AB022214_15150070.003Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5F14.
JMSF030G23Sequence554006462 (2)gb:AY058855_15643922e-22Arabidopsis thaliana AT3g20680/F3H11_7 mRNA, complete cds.>gb:AY143863_1583320 A695012719 (3)gb:AB022214_15150071e-43Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5F14.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027I07+ TCACCACGGGCTTTGGGTACAAAC
                      ____________________________________________________________
consensus TCACCACGGGCTTTGGGTACAAAC
 
. : . : . : . : . : . :
JMSF027I07+ TGTCAGTGATATTCTTCATAGCTTCAAGCTGTGAAACCTCCGGCCCCAAAAACACAACCA
                      ____________________________________________________________
consensus TGTCAGTGATATTCTTCATAGCTTCAAGCTGTGAAACCTCCGGCCCCAAAAACACAACCA
 
. : . : . : . : . : . :
JMSF030G23+ GTCGTCCCCGTTAGTTACCGACAAAACGTCTA
JMSF027I07+ CATCGGAAGAATTCAAAACCCTGCTATTGTCGTCCCCGTTAGTTACCGACAAAACGTCTA
                      ____________________________________________________________
consensus CATCGGAAGAATTCAAAACCCTGCTATTGTCGTCCCCGTTAGTTACCGACAAAACGTCTA
 
. : . : . : . : . : . :
JMSF030G23+ GGTTTTCAACTATGGTGCTCGAAGAACGAGTTTCGAAGGCTTTAGTCTTATCCGGCCACA
JMSF027I07+ GGTTTTCAACTATGGTGCTCGAAGAACGAGTTTCGAAGGCTTTAGTCTTATCCGGCCACA
                      ____________________________________________________________
consensus GGTTTTCAACTATGGTGCTCGAAGAACGAGTTTCGAAGGCTTTAGTCTTATCCGGCCACA
 
. : . : . : . : . : . :
JMSF030G23+ GAATCAGAATCTTGATTTTAGACCCTTTCCTTTTGATGGGCATGTCTGCAAAGACATCAA
JMSF027I07+ GAATCAGAATCTTGATTTTAGACCCTTTCCTTTTGATGGGCATGTCTGCAAAGACATCAA
                      ____________________________________________________________
consensus GAATCAGAATCTTGATTTTAGACCCTTTCCTTTTGATGGGCATGTCTGCAAAGACATCAA
 
. : . : . : . : . : . :
JMSF030G23+ CCGCGAGCTGAGAGAGTGAAGAGGGCGAGTCATCGATCACCGGAATCTCGACCCGGAATC
JMSF027I07+ CCGCGAGCTGAGAGAGTGAAGAGGGCGAGTCATCGATCACCGGAATCTCGACCCGGAATC
                      ____________________________________________________________
consensus CCGCGAGCTGAGAGAGTGAAGAGGGCGAGTCATCGATCACCGGAATCTCGACCCGGAATC
 
. : . : . : . : . : . :
JMSF030G23+ TGGGTTGCTTTAGCTTCTTGAGCCGGCCGGCGAGTTTGGCATTGTTGAGGGGCTTCTCTA
JMSF027I07+ TGGGTTGCTTTAGCTTCTTGAGCCGGCCGGCGAGTTTGGCATTGTTGAGGGGCTTCTCTA
                      ____________________________________________________________
consensus TGGGTTGCTTTAGCTTCTTGAGCCGGCCGGCGAGTTTGGCATTGTTGAGGGGCTTCTCTA
 
. : . : . : . : . : . :
JMSF030G23+ AACTGGTGGAAAGAGAGGTCTTTGCCTGGGAAATAGCTTCTTCCTTGGTGGTAGGTGGGG
JMSF027I07+ AACTGGTGGAAAGAGAGGTCTTTGCCTGGGAAATAGCTTCTTCCTTGGTGGTAGGTGGGG
                      ____________________________________________________________
consensus AACTGGTGGAAAGAGAGGTCTTTGCCTGGGAAATAGCTTCTTCCTTGGTGGTAGGTGGGG
 
. : . : . : . : . : . :
JMSF030G23+ -GGGGGAGGAGAGAGCACACTGGGGGAATCTTGATTTGGTTAAGGAAATAGAAAGGTGAT
JMSF027I07+ TGGGGGAGGAGAGAGCACACTGGGGGAATCTTGATTTGGTTAAGGAAATAGAAAGGTGAT
                      ____________________________________________________________
consensus TGGGGGAGGAGAGAGCACACTGGGGGAATCTTGATTTGGTTAAGGAAATAGAAAGGTGAT
 
. : . : . : . : . : . :
JMSF030G23+ CACAGTGAAGAAGATGATGATGATGGCGTGGAGGGGAGAAGAAAGATGGATACTGAATTT
JMSF027I07+ CACAGTGAAGAAGATGATGATGATGGCGTGGAGGGGAGAAGAAAGATGGATACTGAATTT
                      ____________________________________________________________
consensus CACAGTGAAGAAGATGATGATGATGGCGTGGAGGGGAGAAGAAAGATGGATACTGAATTT
 
. : . : . : . : . : . :
JMSF030G23+ GTGTCAGCTTGAAATGGAAATTGGGGTTTGAAGTTCTGATGAATTGAGAGTGGAATTTTA
JMSF027I07+ GTGTCAGCTTGAAATGGAAATTGGGGTTTGAAGTTCTGATGAATTGAGAGTGGAATTTTA
                      ____________________________________________________________
consensus GTGTCAGCTTGAAATGGAAATTGGGGTTTGAAGTTCTGATGAATTGAGAGTGGAATTTTA
 
. : . : . : . : . : . :
JMSF030G23+ CAAGATTGGAAGCCATTTTAGTATGCAGAGTTTCTGCAAATC
JMSF027I07+ CAAGATTGGAAGCCATTTTAGTATGCAGAGTTCCTGCAAATCAAGAACGTTTAGTGCCCC
                      ____________________________________________________________
consensus CAAGATTGGAAGCCATTTTAGTATGCAGAGTTTCTGCAAATCAAGAACGTTTAGTGCCCC