Previous Contig 006460:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007A15Sequence533006460 (5)gb:LLU421009_16851091e-57Lupinus luteus mRNA for diphosphonucleotide phosphatase 1 (ppd1 gene).720008472 (5)gb:LLU421010_1685110e-106Lupinus luteus mRNA for putative metallophosphatase (ppd2 gene).
JMFF014A24Sequence536006460 (5)gb:LLU421009_16851094e-58Lupinus luteus mRNA for diphosphonucleotide phosphatase 1 (ppd1 gene).810008472 (5)gb:LLU421010_1685110e-121Lupinus luteus mRNA for putative metallophosphatase (ppd2 gene).
JMFF031O02Sequence544006460 (5)gb:LLU421009_16851091e-59Lupinus luteus mRNA for diphosphonucleotide phosphatase 1 (ppd1 gene).792008472 (5)gb:LLU421010_1685110e-105Lupinus luteus mRNA for putative metallophosphatase (ppd2 gene).
JMSF014O14Sequence455006460 (5)gb:LLU421009_16851096e-27Lupinus luteus mRNA for diphosphonucleotide phosphatase 1 (ppd1 gene).750008472 (5)gb:LLU421010_1685110e-115Lupinus luteus mRNA for putative metallophosphatase (ppd2 gene).
JMSF027H24Sequence652006460 (5)gb:LLU421009_16851091e-56Lupinus luteus mRNA for diphosphonucleotide phosphatase 1 (ppd1 gene).724008472 (5)gb:LLU421010_1685110e-105Lupinus luteus mRNA for putative metallophosphatase (ppd2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031O02+ CTGG
                      ____________________________________________________________
consensus CTGG
 
. : . : . : . : . : . :
JMFF031O02+ GCTAACCGTGGGTATAAAGGTGCGTTTGGATTTGCAAAGGCAACTGTATTCGAGACTGCC
JMFF014A24+ TGGGTATAAAGGTGCGTTTGGATTTGCAAAGGCAACTGTATTCGAGACTGCC
JMFF007A15+ TGGGTATAAAGGTGCGTTTGGATTTGCAAAGGCAACTGTATTCGAGACTGCC
JMSF027H24+ TGGGTATAAAGGTGCGTTTGGANTTGCAAAGGCAACTGTATTCGAGACTGCC
                      ____________________________________________________________
consensus GCTAACCGTGGGTATAAAGGTGCGTTTGGATTTGCAAAGGCAACTGTATTCGAGACTGCC
 
. : . : . : . : . : . :
JMFF031O02+ ACCAGCTTTGGTGTCGAGAGTCCACCAGTGAACAACACAAAAGAGAAGTCAAATCTCTGA
JMFF014A24+ ACCAGCTTTGGTGTCGAGAGTCCACCAGTGAACAACACAAAAGAGAAGTCAAATCTCTGA
JMFF007A15+ ACCAGCTTTGGTGTCGAGAGTCCACCAGTGAACAACACAAAAGAGAAGTCAAATCTCTGA
JMSF027H24+ ACCAGCTTTGGTGTCGAGAGTCCACCAGTGAACAACACAAAAGAGAAGTCAAATCTCTGA
                      ____________________________________________________________
consensus ACCAGCTTTGGTGTCGAGAGTCCACCAGTGAACAACACAAAAGAGAAGTCAAATCTCTGA
 
. : . : . : . : . : . :
JMFF031O02+ TTGATCAATTGGAGCTTCAATGATCCTTTCCCCGTGTCTTTGTAACCAGGGCTCGCATAA
JMFF014A24+ TTGATCAATTGGAGCTTCAATGATCCTTTCCCCGTGTCTTTGTAACCAGGGCTCGCATAA
JMFF007A15+ TTGATCAATTGGAGCTTCAATGATCCTTTCCCCGTGTCTTTGTAACCAGGGCTCGCATAA
JMSF027H24+ TTGATCAATTGGAGCTTCAATGATCCTTTCCCCGTGTCTTTGTAACCAGGGCTCGCATAA
                      ____________________________________________________________
consensus TTGATCAATTGGAGCTTCAATGATCCTTTCCCCGTGTCTTTGTAACCAGGGCTCGCATAA
 
. : . : . : . : . : . :
JMFF031O02+ TTTGCAAATTGATACTTTATGGGTGCTGTACACAATAGTGGCGGAAACATTCTTGGATTT
JMFF014A24+ TTTGCAAATTGATACTTTATGGGTGCTGTACACAATAGTGGCGGAAACATTCTTGGATTT
JMFF007A15+ TTTGCAAATTGATACTTTATGGGTGCTGTACACAATAGTGGCGGAAACATTCTTGGATTT
JMSF014O14+ TGGGTGCTGTACACAATAGTGGCGGAAACATTCTTGGATTT
JMSF027H24+ TTTGCAAATTGATACTTTATGGGTGCTGTACACAATAGTGGCGGAAACATTCTTGGATTT
                      ____________________________________________________________
consensus TTTGCAAATTGATACTTTATGGGTGCTGTACACAATAGTGGCGGAAACATTCTTGGATTT
 
. : . : . : . : . : . :
JMFF031O02+ TCACGAACACAAGTTGATTGACTGAAGTTGGCTGGTGAAAATACTCCAATCCAATCATCA
JMFF014A24+ TCACGAACACAAGTTGATTGACTGAAGTTGGCTGGTGAAAATACTCCAATCCAATCATCA
JMFF007A15+ TCACGAACACAAGTTGATTGACTGAAGTTGGCTGGTGAAAATACTCCAATCCAATCATCA
JMSF014O14+ TCACGAACACAAGTTGATTGACTGAAGTTGGCTGGTGAAAATACTCCAATCCAATCATCA
JMSF027H24+ TCACGAACACAAGTTGATTGACTGAAGTTGGCTGGTGAAAATACTCCAATCCAATCATCA
                      ____________________________________________________________
consensus TCACGAACACAAGTTGATTGACTGAAGTTGGCTGGTGAAAATACTCCAATCCAATCATCA
 
. : . : . : . : . : . :
JMFF031O02+ ATTGAAGGGTTTGACACACTGTATTCTAGAGTAACCCATTCTTGGTTTTGGCCGTTGCCT
JMFF014A24+ ATTGAAGGGTTTGACACACTGTATTCTAGAGTAACCCATTCTTGGTTTTGGCCGTTGCCT
JMFF007A15+ ATTGAAGGGTTTGACACACTGTATTCTAGAGTAACCCATTCTTGGTTTTGGCCGTTGCCT
JMSF014O14+ ATTGAAGGGTTTGACACACTGTATTCTAGAGTAACCCATTCTTGGTTTTGGCCGTTGCCT
JMSF027H24+ ATTGAAGGGTTTGACACACTGTATTCTAGAGTAACCCATTCTTGGTTTTGGCCGTTGCCT
                      ____________________________________________________________
consensus ATTGAAGGGTTTGACACACTGTATTCTAGAGTAACCCATTCTTGGTTTTGGCCGTTGCCT
 
. : . : . : . : . : . :
JMFF031O02+ CCAAGAACCGAAGGGGTGGCTTTAATGTATGCATCTTTGTCAAAAGCAAGAACCGTCTTA
JMFF014A24+ CCAAGAACCGAAGGGGTGGCTTTAATGTATGCATCTTTGTCAAAAGCAAGAACCGTCTTA
JMFF007A15+ CCAAGAACCGAAGGGGTGGCTTTAATGTATGCATCTTTGTCAAAAGCAAGAACCGTCTTA
JMSF014O14+ CCAAGAACCGAAGGGGTGGCTTTAATGTATGCATCTTTGTCAAAAGCAAGAACCGTCTTA
JMSF027H24+ CCAAGAACCGAAGGGGTGGCTTTAATGTATGCATCTTTGTCAAAAGCAAGAACCGTCTTA
                      ____________________________________________________________
consensus CCAAGAACCGAAGGGGTGGCTTTAATGTATGCATCTTTGTCAAAAGCAAGAACCGTCTTA
 
. : . : . : . : . : . :
JMFF031O02+ TGAATTGCAATCCTGGCAAGAGGGTGCTCCTTGTGAGATGCTATCACTTGAAGGCTAAGC
JMFF014A24+ TGAATTGCAATCCTGGCAAGAGGGTGCTCCTTGTGAGATGCTATCACTTGAAGGCTAAGC
JMFF007A15+ TGAATTGCAATCCTGGCAAGAGGGTGCTCCTTGTGAGATGCTATCACTTGAAGGCTAAGC
JMSF014O14+ TGAATTGCAATCCTGGCAAGAGGGTGCTCCTTGTGAGATGCTATCACTTGAAGGCTAAGC
JMSF027H24+ TGAATTGCAATCCTGGCAAGAGGGTGCTCCTTGTGAGATGCTATCACTTGAAGGCTAAGC
                      ____________________________________________________________
consensus TGAATTGCAATCCTGGCAAGAGGGTGCTCCTTGTGAGATGCTATCACTTGAAGGCTAAGC
 
. : . : . : . : . : . :
JMFF031O02+ AGAAACCAGAATATCGGTAACAACTTCTTGGAGATTCCCATTATCAAAGCAGGCATGAAC
JMFF014A24+ AGAAACCAGAATATCGGTAACAACTTCTTGGAGATTCCCATTATCAAAGCAGGCATGAAC
JMFF007A15+ AGAAACCAGAATATCGGTAACAACTTCTTGGAGATTCCCATTATCAAAGCAGGCATGAAC
JMSF014O14+ AGAAACCAGAATATCGGTAACAACTTCTTGGAGATTCCCATTATCAAAGCAGGCATGAAC
JMSF027H24+ AGAAACCAGAATATCGGTAACAACTTCTTGGAGATTCCCATTATCAAAGCAGGCATGAAC
                      ____________________________________________________________
consensus AGAAACCAGAATATCGGTAACAACTTCTTGGAGATTCCCATTATCAAAGCAGGCATGAAC
 
. : . : . : . : . : . :
JMSF014O14+ ACCCACACTTAACTCAATTCCGTGTAGAAATGAAAAATCTTGAGCAGAAACTATCTCTGC
JMSF027H24+ ACCCACACTTAACTCAATTCCGTGTAGAAATGAAAAATCTTGAGCAGAAACTATCTCTGC
                      ____________________________________________________________
consensus ACCCACACTTAACTCAATTCCGTGTAGAAATGAAAAATCTTGAGCAGAAACTATCTCTGC
 
. : . : . : . : . : . :
JMSF014O14+ GGAAGTATCTAAAGAGGCAGTGAGTGTGAGGCTCCGTCCCAATGCTAGACGTC
JMSF027H24+ GGAAGTATCTAAAGAGGCAGTGAGTGTGAGGCTCCGTCCCAATGCTAGACGTCAAAATCC
                      ____________________________________________________________
consensus GGAAGTATCTAAAGAGGCAGTGAGTGTGAGGCTCCGTCCCAATGCTAGACGTCAAAATCC