Previous Contig 006452:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025F13Sequence190006452 (4)
JMFS058D09Sequence637006452 (4)gb:AY099702_15767274e-49Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843
JMFS159B06Sequence385006452 (4)gb:AY099702_15767271e-34Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843
JMSF027G17Sequence116006452 (4)601023273gb:AY099702_15767273e-43Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS058D09+ CATCAGCACCAGAAGCAAGGAGATTCGGAGTAAAAGCATTAAATTCCAATCCATGAA
                      ____________________________________________________________
consensus CATCAGCACCAGAAGCAAGGAGATTCGGAGTAAAAGCATTAAATTCCAATCCATGAA
 
. : . : . : . : . : . :
JMFS058D09+ CAGGCCCACTATGCTTTGAAAGGTGACCAACAAAGGCATTTTCAGTAGCTTCAGTGCCAG
                      ____________________________________________________________
consensus CAGGCCCACTATGCTTTGAAAGGTGACCAACAAAGGCATTTTCAGTAGCTTCAGTGCCAG
 
. : . : . : . : . : . :
JMFS159B06+ GCCTGGGATTCCACAGCCCAATGTGGCCATCAA
JMFS058D09+ TTTGATTTGCACCAGAGGAGATCAGAGGCCTGGGATTCCACAGCCCAATGTGGCCATCAA
                      ____________________________________________________________
consensus TTTGATTTGCACCAGAGGAGATCAGAGGCCTGGGATTCCACAGCCCAATGTGGCCATCAA
 
. : . : . : . : . : . :
JMFS159B06+ CAAGCCCACCCGCGATGAGCCCGAGAGAAAACTGCTCGGAATTCGGAAGAGCCTTCCCCC
JMFS058D09+ CAAGCCCACCCGCGATGAGCCCGAGAGAAAACTGCTCGGAATTCGGAAGAGCCTTCCCCC
                      ____________________________________________________________
consensus CAAGCCCACCCGCGATGAGCCCGAGAGAAAACTGCTCGGAATTCGGAAGAGCCTTCCCCC
 
. : . : . : . : . : . :
JMFS159B06+ AAGACAACCGGTTGAAGCGCTCGGAGCTGGTAACCGAGCCGGCCAAAATGAGCTGCTGAT
JMFS058D09+ AAGACAACCGGTTGAAGCGCTCGGAGCTGGTAACCGAGCCGGCCAAAATGAGCTGCTGAT
                      ____________________________________________________________
consensus AAGACAACCGGTTGAAGCGCTCGGAGCTGGTAACCGAGCCGGCCAAAATGAGCTGCTGAT
 
. : . : . : . : . : . :
JMFS159B06+ CATCTGATCCGAAGTCGAGCTTGAAAATGTCGAGGTTGGCCGAGGAGCTGAATGACAGAT
JMFS058D09+ CATCTGATCCGAAGTCGAGCTTGAAAATGTCGAGGTTGGCCGAGGAGCTGAATGACAGAT
                      ____________________________________________________________
consensus CATCTGATCCGAAGTCGAGCTTGAAAATGTCGAGGTTGGCCGAGGAGCTGAATGACAGAT
 
. : . : . : . : . : . :
JMFS159B06+ CCACCGCCCCCGCCATCGTCCCGGCCGCCAAGTACGGCCCCTCCGGCGCAAAGGACGCCG
JMFS058D09+ CCACCGCCCCCGCCATCGTCCCGGCCGCCAAGTACGGCCCCTCCGGCGCAAAGGACGCCG
                      ____________________________________________________________
consensus CCACCGCCCCCGCCATCGTCCCGGCCGCCAAGTACGGCCCCTCCGGCGCAAAGGACGCCG
 
. : . : . : . : . : . :
JMFS159B06+ AGGCCGATCGATTGACAACCTTCACAAACGCCATGCCTCACC
JMFS058D09+ AGGCCGATCGATTGACAACCTTCACAAACGCCATGCCTCACCCAATCTATCCAACTCTAT
                      ____________________________________________________________
consensus AGGCCGATCGATTGACAACCTTCACAAACGCCATGCCTCACCCAATCTATCCAACTCTAT
 
. : . : . : . : . : . :
JMFS058D09+ ACAAATTCGTGCCCGTTGGCACAACCCAATCTTAGGGTTTAATAGGATCGGGCGCACCCG
                      ____________________________________________________________
consensus ACAAATTCGTGCCCGTTGGCACAACCCAATCTTAGGGTTTAATAGGATCGGGCGCACCCG
 
. : . : . : . : . : . :
JMFS058D09+ XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTGTTTATGCTCTCTC-TTATTCAAAT
JMFF025F13+ TGTTTATGCTCTCTC-TTATTCAAAT
JMSF027G17+ TGTTTATGCTCTCTCATTATTCAAAT
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTATGCTCTCTC-TTATTCAAAT
 
. : . : . : . : . : . :
JMFS058D09+ TCTTTACGGATTTCCGATTTCACTTTCACTCTCTCCCCGT
JMFF025F13+ TCTTTACGGATTTCCGATTTCACTTTCACTCTCTCCCCGTCTGTTACTCTCATC
JMSF027G17+ TCTTTACGGATTTCNGATTTCACTTTCACTCTCTCCCCGTNTGTTACTCTCATCGCCTCA
                      ____________________________________________________________
consensus TCTTTACGGATTTCCGATTTCACTTTCACTCTCTCCCCGTCTGTTACTCTCATCGCCTCA