Previous Contig 006442:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026E17Sequence607006442 (4)gb:AF227623_17788611e-12Euphorbia esula unknown mRNA.557006442 (4)gb:AF227623_17788619e-13Euphorbia esula unknown mRNA.
JMSF027E17Sequence608006442 (4)gb:AF227623_17788611e-12Euphorbia esula unknown mRNA.515006442 (4)gb:AF227623_17788617e-13Euphorbia esula unknown mRNA.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF026E17+ GAGGCATA
rJMSF027E17+ GAGGCATA
JMSF026E17- GAGGCATA
JMSF027E17- GAGGCATA
                      ____________________________________________________________
consensus GAGGCATA
 
. : . : . : . : . : . :
rJMSF026E17+ TATGCAATTCTTCAGTACAAGTAATTGTTCACATTCTTGTCTTGTTCATACAGGTTTTGG
rJMSF027E17+ TATGCAATTCTTCAGTACAAGTAATTGTTCACATTCTTGTCTTGTTCATACAGGTTTTGG
JMSF026E17- TATGCAATTCTTCAGTACAAGTAATTGTTCACATTCTTGTCTTGTTCATACAGGTTTTGG
JMSF027E17- TATGCAATTCTTCAGTACAAGTAATTGTTCACATTCTTGTCTTGTTCATACAGGTTTTGG
                      ____________________________________________________________
consensus TATGCAATTCTTCAGTACAAGTAATTGTTCACATTCTTGTCTTGTTCATACAGGTTTTGG
 
. : . : . : . : . : . :
rJMSF026E17+ AGCAGAAAATAATGGCTACGGCAGCAGCATCAGCCTCGGCTACCCTTTCACCCGCGGCGA
rJMSF027E17+ AGCAGAAAATAATGGCTACGGCAGCAGCATCAGCCTCGGCTACCCTTTCACCCGCGGCGA
JMSF026E17- AGCAGAAAATAATGGCTACGGCAGCAGCATCAGCCTCGGCTACCCTTTCACCCGCGGCGA
JMSF027E17- AGCAGAAAATAATGGCTACGGCAGCAGCATCAGCCTCGGCTACCCTTTCACCCGCGGCGA
                      ____________________________________________________________
consensus AGCAGAAAATAATGGCTACGGCAGCAGCATCAGCCTCGGCTACCCTTTCACCCGCGGCGA
 
. : . : . : . : . : . :
rJMSF026E17+ TGGTTGTCGCCGCAAAGACCAACAGGTTTTCCCAGAGAAGAAGCACCAAAGTGAGGTACA
rJMSF027E17+ TGGTTGTCGCCGCAAAGACCAACAGGTTTTCCCAGAGAAGAAGCACCAAAGTGAGGTACA
JMSF026E17- TGGTTGTCGCCGCAAAGACCAACAGGTTTTCCCAGAGAAGAAGCACCAAAGTGAGGTACA
JMSF027E17- TGGTTGTCGCCGCAAAGACCAACAGGTTTTCCCAGAGAAGAAGCACCAAAGTGAGGTACA
                      ____________________________________________________________
consensus TGGTTGTCGCCGCAAAGACCAACAGGTTTTCCCAGAGAAGAAGCACCAAAGTGAGGTACA
 
. : . : . : . : . : . :
rJMSF026E17+ TTAGAGGGCTGAATTCATTTGAAGGCCTCAAGGCGCATAACCATGTTGCCGCATTAGGCG
rJMSF027E17+ TTAGAGGGCTGAATTCATTTGAAGGCCTCAAGGCGCATAACCATGTTGCCGCATTAGGCG
JMSF026E17- TTAGAGGGCTGAATTCATTTGAAGGCCTCAAGGCGCATAACCATGTTGCCGCATTAGGCG
JMSF027E17- TTAGAGGGCTGAATTCATTTGAAGGCCTCAAGGCGCATAACCATGTTGCCGCATTAGGCG
                      ____________________________________________________________
consensus TTAGAGGGCTGAATTCATTTGAAGGCCTCAAGGCGCATAACCATGTTGCCGCATTAGGCG
 
. : . : . : . : . : . :
rJMSF026E17+ TCCCTGTTTGCGCTGACCACTCGTTTGCAAAGATTGTAAGCTCACTGAGACCACGAGGCA
rJMSF027E17+ TCCCTGTTTGCGCTGACCACTCGTTTGCAAAGATTGTAAGCTCACTGAGACCACGAGGCA
JMSF026E17- TCCCTGTTTGCGCTGACCACTCGTTTGCAAAGATTGTAAGCTCACTGAGACCACGAGGCA
JMSF027E17- TCCCTGTTTGCGCTGACCACTCGTTTGCAAAGATTGTAAGCTCACTGAGACCACGAGGCA
                      ____________________________________________________________
consensus TCCCTGTTTGCGCTGACCACTCGTTTGCAAAGATTGTAAGCTCACTGAGACCACGAGGCA
 
. : . : . : . : . : . :
rJMSF026E17+ AGGGTAATGGCGGTGGAGCTCTCTCTGCAAGCTGCAATGCCATCGCCGAGATTTTCAGGA
rJMSF027E17+ AGGGTAATGGCGGTGGAGCTCTCTCTGCAAGCTGCAATGCCATCGCCGAGATTTTCAGGA
JMSF026E17- AGGGTAATGGCGGTGGAGCTCTCTCTGCAAGCTGCAATGCCATCGCCGAGATTTTCAGGA
JMSF027E17- AGGGTAATGGCGGTGGAGCTCTCTCTGCAAGCTGCAATGCCATCGCCGAGATTTTCAGGA
                      ____________________________________________________________
consensus AGGGTAATGGCGGTGGAGCTCTCTCTGCAAGCTGCAATGCCATCGCCGAGATTTTCAGGA
 
. : . : . : . : . : . :
rJMSF026E17+ TTGCTGCCATAATCCCTGGCCTTGTTCTTGTTGGAGTCGCTGTCGGTTTCGTCCTCCTCC
rJMSF027E17+ TTGCTGCCATAATCCCTGGCCTTGTTCTTGTTGGAGTCGCTGTCGGTTTCGTCCTCCTCC
JMSF026E17- TTGCTGCCATAATCCCTGGCCTTGTTCTTGTTGGAGTCGCTGTCGGTTTCGTCCTCCTCC
JMSF027E17- TTGCTGCCATAATCCCTGGCCTTGTTCTTGTTGGAGTCGCTGTCGGTTTCGTCCTCCTCC
                      ____________________________________________________________
consensus TTGCTGCCATAATCCCTGGCCTTGTTCTTGTTGGAGTCGCTGTCGGTTTCGTCCTCCTCC
 
. : . : . : . : . : . :
rJMSF026E17+ GAGTTGAAGCTTACCTGGAGGAATCTGAAGAATGAAGTTATGGCAAGTCTGGTGGTTGGT
rJMSF027E17+ GAGTTGAAGCTTACCTGGAGGAATCTGAAGAATGAAGTTATGGCAAGTCTGGTGGTTGGT
JMSF026E17- GAGTTGAAGCTTACCTGGAGGAATCTGAAGAATGAAGTTATGGCAAGTCTGGTGGTTGGT
JMSF027E17- GAGTTGAAGCTTACCTGGAGGAATCTGAAGAATGAAGTTATGGCAAGTCTGGTGGTTGGT
                      ____________________________________________________________
consensus GAGTTGAAGCTTACCTGGAGGAATCTGAAGAATGAAGTTATGGCAAGTCTGGTGGTTGGT
 
. : . : . : . : . : . :
rJMSF026E17+ TCAGAGTTCTTTTTCAATAATCAAGGTCAATGTGCTTTTGAATTGGTTCCATGTTTTGTC
rJMSF027E17+ TCAGAGTTCTTTTTCAATAATCAAGGT
JMSF026E17- TCAGAGTTCTTTTTCAATAATCAAGGTCAATGTGCTTTTGAATTGGTTCCATGTTTTGTC
JMSF027E17- TCAGAGTTCTTTTTCAATAATCAAGGTCAATGTGCTTTTGAATTGGTTCCATGTTTTGTC
                      ____________________________________________________________
consensus TCAGAGTTCTTTTTCAATAATCAAGGTCAATGTGCTTTTGAATTGGTTCCATGTTTTGTC
 
. : . : . : . : . : . :
rJMSF026E17+ TTGTATATT
JMSF026E17- TTGTATATTTGTTCTGTTGGGGCAACATATATATAACTAAGATATCTTTGCCTCTCTTT
JMSF027E17- TTGTATATTTGTTCTGTTGGGGCAACATATATATAACTAAGATATCTTTGCCTCTCTTTC
                      ____________________________________________________________
consensus TTGTATATTTGTTCTGTTGGGGCAACATATATATAACTAAGATATCTTTGCCTCTCTTTC