Previous Contig 006439:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS010F04Sequence605006439 (7)gb:NTA319872_16913443e-42Nicotiana tabacum mRNA for putative carbamoyl phosphate synthase large subunit (
JMFS012A11Sequence627006439 (7)gb:NTCARBSYN_16915054e-16N.tabacum mRNA for putative carbamoyl phosphate synthetase, partial.
JMFS125A07Sequence576006439 (7)gb:NTA319872_16913445e-96Nicotiana tabacum mRNA for putative carbamoyl phosphate synthase large subunit (
JMFS149D06Sequence605006439 (7)gb:NTA319872_16913442e-64Nicotiana tabacum mRNA for putative carbamoyl phosphate synthase large subunit (
JMFS157B12Sequence512006439 (7)gb:NTA319872_16913441e-77Nicotiana tabacum mRNA for putative carbamoyl phosphate synthase large subunit (
JMSF027E10Sequence654006439 (7)gb:NTCARBSYN_16915051e-16N.tabacum mRNA for putative carbamoyl phosphate synthetase, partial.782012535 (2)gb:NTA319872_16913445e-89Nicotiana tabacum mRNA for putative carbamoyl phosphate synthase large subunit (
JMSF034G19Sequence632006439 (7)gb:NTCARBSYN_16915051e-17N.tabacum mRNA for putative carbamoyl phosphate synthetase, partial.707012535 (2)gb:NTA319872_16913445e-74Nicotiana tabacum mRNA for putative carbamoyl phosphate synthase large subunit (

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS125A07+ ATCCCAAC
                      ____________________________________________________________
consensus ATCCCAAC
 
. : . : . : . : . : . :
JMFS125A07+ AAAGACTTTTCAACCAGAACCTGTGATGTCAAACTAGCAGCAAGCCCCGACTTACATATG
                      ____________________________________________________________
consensus AAAGACTTTTCAACCAGAACCTGTGATGTCAAACTAGCAGCAAGCCCCGACTTACATATG
 
. : . : . : . : . : . :
JMFS125A07+ GCCTCGAATTCCTCTCTGTTGTAGGCAATCCCACCTCCAGTTCCACCCAGCGTGAATGCT
                      ____________________________________________________________
consensus GCCTCGAATTCCTCTCTGTTGTAGGCAATCCCACCTCCAGTTCCACCCAGCGTGAATGCT
 
. : . : . : . : . : . :
JMFS125A07+ GGACGTATTATCAACGGGAACTCCCCTATCGTATTAGCAATCTCAAAACACTCCTCGAGA
                      ____________________________________________________________
consensus GGACGTATTATCAACGGGAACTCCCCTATCGTATTAGCAATCTCAAAACACTCCTCGAGA
 
. : . : . : . : . : . :
JMFS125A07+ GTTGTCCCGATCCCAGAAGGAGGTGTCTTGAGCCCAATATTGTTCATTGCCTGCTTGAAC
JMFS157B12+ GTCCCAATCCCGGAAGGGGGTGTCTTTAGCCCAATGTTCTTCATAGCCTGCTTAAAC
                      ____________________________________________________________
consensus GTTGTCCCGATCCCGGAAGGGGGTGTCTTTAGCCCAATGTTGTTCATTGCCTGCTTGAAC
 
. : . : . : . : . : . :
JMFS125A07+ AGATCCCTATCCTCCGCCTTCTTGATGCAATCAAGCTTCGCCCCAATCAACTCAACACCA
JMFS157B12+ AGATCCCTATCCTCTGCCTTCTTGATGGCATCGAGTTTCGCCCCAATCAACTCCACACCA
JMFS149D06+ TTCGCCCCAATCAACTCCACACCA
                      ____________________________________________________________
consensus AGATCCCTATCCTCTGCCTTCTTGATGGCATCGAGTTTCGCCCCAATCAACTCCACACCA
 
. : . : . : . : . : . :
JMFS125A07+ TACTTCTCAAGCGCCCCGCTCTCAGCCAATGCCACTGCAAGGTTAAGAGCAGTCTGGCCA
JMFS157B12+ TACTTGTCAAGAACCCCGCTCTCGGCCAAAGCCACCGCGAGGTTGAGAGCCGTCTGGCCG
JMFS149D06+ TACTTGTCAAGAACNCCGCTCTCGGCCAAAGCCACCGCGAGGTTGAGAGCCGTCTGGCCG
                      ____________________________________________________________
consensus TACTTGTCAAGAACCCCGCTCTCGGCCAAAGCCACCGCGAGGTTGAGAGCCGTCTGGCCG
 
. : . : . : . : . : . :
JMFS125A07+ CCCATGGTGGGCAGCAAAGCATCCGGTCTCTCCTTCTCGAGCACTTGCTCAACAATCTCG
JMFS157B12+ CCCATGGTGGGCAGCAAAGCATCCGGCCGCTCTTTCTCGAGCACCTGCTCCACAAGCTCG
JMFS149D06+ CCCATGGTGGGCAGCAAAGCATCCGGCCGCTCTTTCTCGAGCACCTGCTCCACAAGCTCG
JMFS010F04+ AGCACCTGCTCCACAAGCTCG
                      ____________________________________________________________
consensus CCCATGGTGGGCAGCAAAGCATCCGGCCGCTCTTTCTCGAGCACCTGCTCCACAAGCTCG
 
. : . : . : . : . : . :
JMFS125A07+ GGAGTCAGTGGCTCAATATAAGTCCTATCCGCCATTTCTGGATCAGTCATAATAGTAGCA
JMFS157B12+ GGCGTCATAGGCTCAATATAAGTCCTGTCCGCCATTTCTGGGTCAGTCATAATGGTGGCA
JMFS149D06+ GGCGTCATAGGCTCAATATAAGTCCTGTCCGCCATTTCTGGGTCAGTCATAATGGTGGCA
JMFS010F04+ GGCGTCATAGGCTCAATATAAGTCCTGTCCGCCATTTCTGGGTCAGTCATAATGGTGGCA
                      ____________________________________________________________
consensus GGCGTCATAGGCTCAATATAAGTCCTGTCCGCCATTTCTGGGTCAGTCATAATGGTGGCA
 
. : . : . : . : . : . :
JMFS125A07+ GGATTGGAGTTAATCAGAATCACCTCATACCCCTCTTCCCTGAGAGCCTTACAAGCTTGT
JMFS157B12+ GGGTTTGAGTTAATCAAAATCACCTCGTACCCTTCTTCCCTAAGCGCTTTACACGCCTGC
JMFS149D06+ GGGTTTGAGTTAATCAAAATCACCTCGTACCCTTCTTCCCTAAGCGCTTTACACGCCTGC
JMFS010F04+ GGGTTTGAGTTAATCAAAATCACCTCGTACCCTTCTTCCCTAAGCGCTTTACACGCCTGC
                      ____________________________________________________________
consensus GGGTTTGAGTTAATCAAAATCACCTCGTACCCTTCTTCCCTAAGCGCTTTACACGCCTGC
 
. : . : . : . : . : . :
JMFS125A07+ GTCCCAGAATAATCAAACTCACAGGCTT
JMFS157B12+ GTCCCTGAATAATCAAACTCGCAGGCTTGCCCAATCACTATAGGCCCGGCGCCTAATATC
JMFS149D06+ GTCCCTGAATAATCAAACTCGCAGGCTTGCCCAATCACTATAGGCCCGGCGCCTAATATC
JMFS010F04+ GTCCCTGAATAATCAAACTCGCAGGCTTGCCCAATCACTATAGGCCCGGCGCCTAATATC
JMSF034G19+ AATAATCAAACTCGCAGGCTTGCCCAATCACTATAGGCCCGGCGCCTAATATC
JMFS012A11+ CAAACTCGCAGGCTTGCCCAATCACTATAGGCCCGGCGCCTAATATC
JMSF027E10+ GAATAATCAAACTCGCAGGCTTGCCCAATCACTATAGGCCAGGCGCCTAATATC
                      ____________________________________________________________
consensus GTCCCTGAATAATCAAACTCGCAGGCTTGCCCAATCACTATAGGCCCGGCGCCTAATATC
 
. : . : . : . : . : . :
JMFS157B12+ AAAATCCTTTTGATATCCGTCCTCTTCCCCACCACCGTTTGCTTACTAGAACCCTCACTG
JMFS149D06+ AAAATCCTTTTGATATCCGTCCTCTTCCCCACCACCGTTTGCTTACTAGAACCCTCACTG
JMFS010F04+ AAAATCCTTTTGATATCCGTCCTCTTCCCCACCACCGTTTGCTTACTAGAACCCTCACTG
JMSF034G19+ AAAATCCTTTTGATATCCGTCCTCTTCCCCACCACCGTTTGCTTACTAGAACCCTCACTG
JMFS012A11+ AAAATCCTTTTGATATCCGTCCTCTTCCCCACCACCGTTTGCTTACTAGAACCCTCACTG
JMSF027E10+ AAAATCCTTTTGATATCCGTCCTCTTCCCCACCACCGTTTGCTTACTAGAACCCTCACTG
                      ____________________________________________________________
consensus AAAATCCTTTTGATATCCGTCCTCTTCCCCACCACCGTTTGCTTACTAGAACCCTCACTG
 
. : . : . : . : . : . :
JMFS157B12+ CCCTGGCATCGAATCGGGCTCGTTCGG
JMFS149D06+ CCCTGGCATCGAATCGGGCTCGTTCGGGCCCAAACTTTGCCCGAACGCAAGACCACGGGC
JMFS010F04+ CCCTGGCATCGAATCGGGCTCGTTCGGGCCCAAACTTTGCCCGAACGCAAGACCACGGGC
JMSF034G19+ CCCTGGCATCGAATCGGGCTCGTTCGGGCCCAAACTTTGCCCGAACGCAAGACCACGGGC
JMFS012A11+ CCCTGGCATCGAATCGGGCTCGTTCGGGCCCAAACTTTGCCCGAACGCAAGACCACGGGC
JMSF027E10+ CCCTGGCATCGAATCGGGCTCGTTCGGGCCCAAACTTTGCCCGAACGCAAGACCACGGGC
                      ____________________________________________________________
consensus CCCTGGCATCGAATCGGGCTCGTTCGGGCCCAAACTTTGCCCGAACGCAAGACCACGGGC
 
. : . : . : . : . : . :
JMFS149D06+ TGATATTGGAGGCTCAAGCATGATGATTTCTTCTTCGCGCTTGTTTTCCTAAACTGGGCA
JMFS010F04+ TGATATTGGAGGCT-AAGCATGATGATTTCTTCTTCGCGCTTGTTTTCCTAAACTGGGCA
JMSF034G19+ TGATATTGGAGGCTCAAGCATGATGATTTCTTCTTCGCGCTTGTTTTCCTAAACTGGGCA
JMFS012A11+ TGATATTGGAGGCTCAAGCATGATGATTTCTTCTTCGCGCTTGTTTTCCTAAACTGGGCA
JMSF027E10+ TGATATTGGAGGCTCAAGCATGATGATTTCTTCTTCGCGCTTGTTTTCCTAAACTGGGCA
                      ____________________________________________________________
consensus TGATATTGGAGGCTCAAGCATGATGATTTCTTCTTCGCGCTTGTTTTCCTAAACTGGGCA
 
. : . : . : . : . : . :
JMFS149D06+ AAAACCCGAAAAGCATCTGATTTGGATAAATAGGGCTTAGCAGGCGCAAGGGTATAGGAC
JMFS010F04+ AAAACCCGAAAAGCATCTGATTTGGATAAATAGGGCTTAGCAGGCGCAAGGGTATAGGAC
JMSF034G19+ AAAACCCGAAAAGCATCTGATTTGGATAAATAGGGCTTAGCAGGCGCAAGGGTATAGGAC
JMFS012A11+ AAAACCCGAAAAGCATCTGATTTGGATAAATAGGGCTTAGCAGGCGCAAGGGTATAGGAC
JMSF027E10+ AAAACCCGAAAAGCATCTGATTTGGATAAATAGGGCTTAGCAGGCGCAAGGGTATAGGAC
                      ____________________________________________________________
consensus AAAACCCGAAAAGCATCTGATTTGGATAAATAGGGCTTAGCAGGCGCAAGGGTATAGGAC
 
. : . : . : . : . : . :
JMFS149D06+ GAAGACGACGAAGAAACGAGCTTGGACACAA
JMFS010F04+ GAAGACGACGAAGAAACGAGCTTGGACACAACATTCTCACAGTGATTCATACAAAACCCC
JMSF034G19+ GAAGACGACGAAGAAACGAGCTTGGACACAACATTCTCACAGTGATTCATACAAAACCCC
JMFS012A11+ GAAGACGACGAAGAAACGAGCTTGGACACAACATTCTCACAGTGATTCATACAAAACCCC
JMSF027E10+ GAAGACGACGAAGAAACGAGCTTGGACACAACATTCTCACAGTGATTCATACAAAACCCC
                      ____________________________________________________________
consensus GAAGACGACGAAGAAACGAGCTTGGACACAACATTCTCACAGTGATTCATACAAAACCCC
 
. : . : . : . : . : . :
JMFS010F04+ ATTTCTCACACTCTAAGTCTCCTCCCTAGTTCCAATGAAGTTTAGTACGAAGACCCTTTT
JMSF034G19+ ATTTCTCACACTCTAAGTCTCCTCCCTAGTTCCAATGAAGTTTAGTACGAAGACCCTTTT
JMFS012A11+ ATTTCTCACACTCTAAGTCTCCTCCCTAGTTCCAATGAAGTTTAGTACGAAGACCCTTTT
JMSF027E10+ ATTTCTCACACTCTAAGTCTCCTCCCTAGTTCCAATGAAGTTTAGTACGAAGACCCTTTT
                      ____________________________________________________________
consensus ATTTCTCACACTCTAAGTCTCCTCCCTAGTTCCAATGAAGTTTAGTACGAAGACCCTTTT
 
. : . : . : . : . : . :
JMFS010F04+ GGGTTTAAGAAGCACTAGGGTTTTCGAGGGGTGAATGTGGCGGGT
JMSF034G19+ GGGTTTAAGAAGCACTAGGGTTTTCGAGGGGTGAATGTGGCGGGTAAAAACCGAGTCTTG
JMFS012A11+ GGGTTTAAGAAGCACTAGGGTTTTCGAGGGGTGAATGTGGCGGGTAAAAACCGAGTCTTG
JMSF027E10+ GGGTTTAAGAAGCACTAGGGTTTTCGAGGGGTGAATGTGGCGGGTAAAAACCGAGTCTTG
                      ____________________________________________________________
consensus GGGTTTAAGAAGCACTAGGGTTTTCGAGGGGTGAATGTGGCGGGTAAAAACCGAGTCTTG
 
. : . : . : . : . : . :
JMSF034G19+ GAAGCTATATGGGGAAAGTTGTGGGAATATATAAAAAGGAAACGGAAATTGCAGAGAATA
JMFS012A11+ GAAGCTATATGGGGAAAGTTGTGGGAATATATAAAAAGGAAACGGAAATTGCAGAGAATA
JMSF027E10+ GAAGCTATATGGGGAAAGTTGTGGGAATATATAAAAAGGAAACGGAAATTGCAGAGAATA
                      ____________________________________________________________
consensus GAAGCTATATGGGGAAAGTTGTGGGAATATATAAAAAGGAAACGGAAATTGCAGAGAATA
 
. : . : . : . : . : . :
JMSF034G19+ TCTGAGTTGGAGGTCAGCTAAAATGTTGTCTTGATAATTATTGGAGTAGATCAGTAGAGT
JMFS012A11+ TCTGAGTTGGAGGTCAGCTAAAATGTTGTCTTGATAATTATTGGAGTAGATCAGTAGAGT
JMSF027E10+ TCTGAGTTGGAGGTCAGCTAAAATGTTGTCTTGATAATTATTGGAGTAGATCAGTAGAGT
                      ____________________________________________________________
consensus TCTGAGTTGGAGGTCAGCTAAAATGTTGTCTTGATAATTATTGGAGTAGATCAGTAGAGT
 
. : . : . : . : . : . :
JMSF034G19+ GGCAGAACTCAGAAGATGAGAGCCGCCGCTCAAAGGCC
JMFS012A11+ GGCAGAACTCAGAAGATGAGAGCCGCCGCTCAAAGGCC
JMSF027E10+ GGCAGAACTCAGAAGATGAGAGCCGCCGCTCAAAGGCCAAAGCAACAAACAACGTTATTC
                      ____________________________________________________________
consensus GGCAGAACTCAGAAGATGAGAGCCGCCGCTCAAAGGCCAAAGCAACAAACAACGTTATTC