Previous Contig 006438:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011G14Sequence518006438 (3)gb:AY290820_15956047e-33Crocus sativus glucosyltransferase-like protein (GLT3) mRNA, complete cds.749012532 (3)gb:OSJN00271_16977194e-51Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0002J11, complete seque
JMSF005A21Sequence346006438 (3)gb:AY290820_15956044e-16Crocus sativus glucosyltransferase-like protein (GLT3) mRNA, complete cds.411007385 (11)gb:AP004565_18416782e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P048
JMSF027E03Sequence658006438 (3)gb:AY290820_15956045e-41Crocus sativus glucosyltransferase-like protein (GLT3) mRNA, complete cds.728012532 (3)pir|T49903|T499031e-43glucosyltransferase-like protein - Arabidopsis thaliana>gb:ATT24H18_1555416 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027E03+ GCTACAATACACCCAAACACCTTCGACCAGGAATCTTCGCCATTTGCAGCTCTCATGA
                      ____________________________________________________________
consensus GCTACAATACACCCAAACACCTTCGACCAGGAATCTTCGCCATTTGCAGCTCTCATGA
 
. : . : . : . : . : . :
JMSF027E03+ AAGCGTGGAGGTGAGAGACGTTATAAAGACAGGAATCGGGAAACGCCGGCATGGTAAACT
                      ____________________________________________________________
consensus AAGCGTGGAGGTGAGAGACGTTATAAAGACAGGAATCGGGAAACGCCGGCATGGTAAACT
 
. : . : . : . : . : . :
JMFF011G14+ GGCGGCGAGATGCGGGAGGTCTCGCCAGATGGACATATAGCACGCGG
JMSF027E03+ CACCGTCGTCGCCGGCGGCGAGATGCGGGAGGTCTCGCCAGATGGACATAAAGCACGTGG
                      ____________________________________________________________
consensus CACCGTCGTCGCCGGCGGCGAGATGCGGGAGGTCTCGCCAGATGGACATATAGCACGTGG
 
. : . : . : . : . : . :
JMFF011G14+ TGCCGTAGGCCCCGGAAGTTGAGAACCCCACGTTCACCGTCCCACAAGACCTGGCCACTT
JMSF027E03+ TGCCGTAGGCTCCGGCAGTTGAGAACCCCACGTTCACCGTCCCACAGGACCTGGCCACTT
                      ____________________________________________________________
consensus TGCCGTAGGCTCCGGCAGTTGAGAACCCCACGTTCACCGTCCCACAGGACCTGGCCACTT
 
. : . : . : . : . : . :
JMFF011G14+ CGCTCGCCCATCCCATGAATACGTCGGAGATTATGCAGAGAGGAGGCTTTCTGTCTTTGG
JMSF027E03+ CGCTCGCCCATCCAATGAACACGTCGGAGATTATGCAGAGAGGAGGCTTTCCATCTTTGG
                      ____________________________________________________________
consensus CGCTCGCCCATCCCATGAATACGTCGGAGATTATGCAGAGAGGAGGCTTTCTGTCTTTGG
 
. : . : . : . : . : . :
JMFF011G14+ CGGCCATATCGGAGATGAAATTGCGCAAAGGGTCCTTGAGGGCAACCGTGGACTGCACCA
JMSF005A21+ TATCGGAGATGAAATTGCGCAAAGGGTCCTTGAGGGCAACCGTGGACTGCACCA
JMSF027E03+ CGGTAATATCGGAGATGAAATTGCGAAAAGGGTCCTTGAGGCCAACCGTAGACCGCACAA
                      ____________________________________________________________
consensus CGGTCATATCGGAGATGAAATTGCGCAAAGGGTCCTTGAGGGCAACCGTGGACTGCACCA
 
. : . : . : . : . : . :
JMFF011G14+ TTGTGAACATGTAGCGCAAAGGCAATGCCTCTGTGTTCTCTACGCCGGGTGGCAAGCCAT
JMSF005A21+ TTGTGAACATGTAGCGCAAAGGCAATGCCTCTGTGTTCTCTACGCCGGGTGGCAAGCCAT
JMSF027E03+ TATTGATCATTTGGTGCAAGGGCAAGCCCTCTGTGTTCTCTGCGCCGGGTGGTAAGCCAT
                      ____________________________________________________________
consensus TTGTGAACATGTAGCGCAAAGGCAATGCCTCTGTGTTCTCTACGCCGGGTGGCAAGCCAT
 
. : . : . : . : . : . :
JMFF011G14+ GGTCGGCGCCGGTGAACGGCAGCGCCGCCAATCGGATTTCTGGATCATCAATGCAGGAGG
JMSF005A21+ GGTCGGCGCCGGTGAACGGCAGCGCCGCCAATCGGATTTCTGGATCATCAATGCAGGAGG
JMSF027E03+ AGTCGGCGCCGTTGAACGGCAGCGCCACCAATCGGATTTCTGGATCATCAATGTAGGAGG
                      ____________________________________________________________
consensus GGTCGGCGCCGGTGAACGGCAGCGCCGCCAATCGGATTTCTGGATCATCAATGCAGGAGG
 
. : . : . : . : . : . :
JMFF011G14+ TGAGATATTGAACGTTGAGAGGAGTAGTAACGATGGTGAGTTTGAAAGCAGTTGTTTGCT
JMSF005A21+ TGAGATATTGAACGTTGAGAGGAGTAGTAACGATGGTGAGTTTGAAAGCAGTTGTTTGCT
JMSF027E03+ TGAGATATTGGACGTTGAGAGGAGTAGTAACGAGGGTGAGTTTGAAAGCAGTTGTTTGCT
                      ____________________________________________________________
consensus TGAGATATTGAACGTTGAGAGGAGTAGTAACGATGGTGAGTTTGAAAGCAGTTGTTTGCT
 
. : . : . : . : . : . :
JMFF011G14+ TGATTTGCTTGGCTAAACCCAAGAATGGAATCATATGGCCATGTGCCATGAATGGCAGCA
JMSF005A21+ TGATTTGCTTGGCTAAACCCAAGAATGGAATCATATGGCCATGTGCCATGAATGGCAGCA
JMSF027E03+ TGATTTGCTTAGCTAAACCCAAGAATGGAATCATATGGCCATGTGCCATGAACGGCAGCA
                      ____________________________________________________________
consensus TGATTTGCTTGGCTAAACCCAAGAATGGAATCATATGGCCATGTGCCATGAATGGCAGCA
 
. : . : . : . : . : . :
JMFF011G14+ TCACTATGTGTTCTGCACATTCTGAACCGCCCATTTCTCCTGT
JMSF005A21+ TCACTATGTGTTCTGCACATTCTGAACCGCCCATTTCTCCTGTGTAT
JMSF027E03+ TCACTATGTGTTCTGCACACTCTGACCCACCCATTTCTTCTGTGTATGGCTAATGGCTTC
                      ____________________________________________________________
consensus TCACTATGTGTTCTGCACATTCTGAACCGCCCATTTCTCCTGTGTATGGCTAATGGCTTC