Previous Contig 006432:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001I19Sequence556006432 (12)691011109 (11)gb:AF110226_17687675e-32Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF003B02Sequence500006432 (12)759011109 (11)gb:AF110226_17687675e-34Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF025E03Sequence525006432 (12)731011109 (11)gb:AF110226_17687676e-33Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF035I16Sequence559006432 (12)762011109 (11)gb:AF110226_17687671e-34Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF047D08Sequence590006432 (12)570011109 (11)gb:AF110226_17687671e-14Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF047P11Sequence590006432 (12)601011109 (11)gb:AF110226_17687679e-23Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF051M03Sequence558006432 (12)619011109 (11)gb:AF110226_17687679e-26Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFS168E01Sequence577006432 (12)
JMSF027C19Sequence746006432 (12)770011109 (11)gb:AF110226_17687672e-33Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMSF039H17Sequence559006432 (12)921011438 (4)gb:AB005239_15094512e-79Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLN1.>gb:BT004813_16378
JMSF046C11Sequence750006432 (12)gb:AJ786380_12842506e-05Cryptosporidium parvum rop-r gene for repeat organellar protein-related, isolate767011109 (11)gb:AF110226_17687678e-45Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMSF047H17Sequence702006432 (12)gb:AJ786380_12842502e-04Cryptosporidium parvum rop-r gene for repeat organellar protein-related, isolate784011109 (11)gb:AF110226_17687677e-39Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047H17+ CC
                      ____________________________________________________________
consensus CC
 
. : . : . : . : . : . :
JMSF047H17+ ACCACGGCGATCGCCACGGAAGCCACCCCTAGATCCACCATAGCNTCNTCTCCTTTCAAA
JMSF046C11+ TCCACCATAGCCTCCTCTCCTTTCAAA
                      ____________________________________________________________
consensus ACCACGGCGATCGCCACGGAAGCCACCCCTAGATCCACCATAGCCTCCTCTCCTTTCAAA
 
. : . : . : . : . : . :
JMSF047H17+ GGTCTTTCCACNTTCTCCATCTTCAGATTGTCTATAACCTCCACCATAGCCTCCTCTCCT
JMSF046C11+ GGTCTTTCCACNTTCTCCATCTTCAGATTGTCTATAACCTCCACCATAGCCTCCTCTCCT
                      ____________________________________________________________
consensus GGTCTTTCCACNTTCTCCATCTTCAGATTGTCTATAACCTCCACCATAGCCTCCTCTCCT
 
. : . : . : . : . : . :
JMSF047H17+ TTCAAATGGCTTTCCACNTTCTCCATCTTCAGATTGTCTATAACCTCCACCATAGCCTCC
JMSF046C11+ TTCAAATGGCTTTCCACCTTCTCCATCTTCAGATTGTCTATAACCTCCACCATAGCCTCC
JMSF027C19+ CATCTTCAGATTGTCTATAACNTCCACCATAGCCTCC
                      ____________________________________________________________
consensus TTCAAATGGCTTTCCACCTTCTCCATCTTCAGATTGTCTATAACCTCCACCATAGCCTCC
 
. : . : . : . : . : . :
JMSF047H17+ TCTCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCGGATTGTCTATAACCTCCACCATA
JMFS168E01+ TCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCGGATTGTCTATAACCTCCACCATA
JMSF046C11+ TCTCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCGGATTGTCTATAACCTCCACCATA
JMSF027C19+ TCTCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCGGATTGTCTATAACCTCCACCATA
                      ____________________________________________________________
consensus TCTCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCGGATTGTCTATAACCTCCACCATA
 
. : . : . : . : . : . :
JMSF047H17+ GCCTCCTCTCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCTGATGGTCTATAACCACC
JMFS168E01+ GCCTCCTCTCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCTGATGGTCTATAACCACC
JMSF046C11+ GCCTCCTCTCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCTGATGGTCTATAACCACC
JMFF047P11+ CCTTTCAAATGGCTTTCCACCTTCTCCATCTTCTGATGGTCTATAACCACC
JMFF051M03+ CAAATGGCTTTCCACCTTCTCCATCTTCTGATGGTCTATAACCACC
JMFF047D08+ CCTTTCAAATGGCTTTCCACCTTCTCCATCTTCTGATGGTCTATAACCACC
JMFF035I16+ TCTGATGGTCTATAACCACC
JMSF039H17+ TTCTGATGGTCTATAACCACC
JMFF001I19+ TTCTGATGGTCTATAACCACC
JMSF027C19+ GCCTCCTCTCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCTGATGGTCTATAACCACC
                      ____________________________________________________________
consensus GCCTCCTCTCCTTTCAAATGGCTTTCCACCTTCTCCATCTTCTGATGGTCTATAACCACC
 
. : . : . : . : . : . :
JMSF047H17+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMFS168E01+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMSF046C11+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMFF047P11+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMFF051M03+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMFF047D08+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMFF035I16+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMSF039H17+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMFF001I19+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMFF025E03+ TGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
JMFF003B02+ AGTAGAATCTTGATTGAACCC
JMSF027C19+ AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
                      ____________________________________________________________
consensus AGCAAAACCATTGTTGTTGCCATAATTATTCTCATTGTTAGTAGAATCTTGATTGAACCC
 
. : . : . : . : . : . :
JMSF047H17+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMFS168E01+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMSF046C11+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMFF047P11+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMFF051M03+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMFF047D08+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMFF035I16+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMSF039H17+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMFF001I19+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMFF025E03+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMFF003B02+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
JMSF027C19+ ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
                      ____________________________________________________________
consensus ACGTCCCCGACCACCACGTCCACCTCCACGTTGACCACGTCCAGCTCCCCGCTGAGGTTC
 
. : . : . : . : . : . :
JMSF047H17+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMFS168E01+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMSF046C11+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMFF047P11+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMFF051M03+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMFF047D08+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMFF035I16+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMSF039H17+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMFF001I19+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMFF025E03+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMFF003B02+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
JMSF027C19+ AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
                      ____________________________________________________________
consensus AGTTTTGGCTTCCCTCACAGCTTGGGAAGGAGGAAGAGGCTTGGAAGGCAACTTGGCAGT
 
. : . : . : . : . : . :
JMSF047H17+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMFS168E01+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMSF046C11+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMFF047P11+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMFF051M03+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMFF047D08+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMFF035I16+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMSF039H17+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMFF001I19+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMFF025E03+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMFF003B02+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
JMSF027C19+ GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
                      ____________________________________________________________
consensus GGCGGCGGCGGCGGCGGCGTTAGGCTTCGCCGGAGCCTGACCAGGAGTCTTCTTGGGAGC
 
. : . : . : . : . : . :
JMSF047H17+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMFS168E01+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMSF046C11+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMFF047P11+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMFF051M03+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMFF047D08+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMFF035I16+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMSF039H17+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMFF001I19+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMFF025E03+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMFF003B02+ CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
JMSF027C19+ AGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
                      ____________________________________________________________
consensus CGAGGCTGGAGTAGGCAGCTTCTGCTGCTGAGCAGCAAGGAGCTGCAATGGATCCTCGTT
 
. : . : . : . : . : . :
JMSF047H17+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMFS168E01+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMSF046C11+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMFF047P11+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMFF051M03+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMFF047D08+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMFF035I16+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMSF039H17+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMFF001I19+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMFF025E03+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMFF003B02+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
JMSF027C19+ GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
                      ____________________________________________________________
consensus GTCATCGTCACCCAGAAGGTCAAAAGGGTTCATCGTCGCCATTTCTGAATCCTTTTCAGA
 
. : . : . : . : . : . :
JMSF047H17+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATT
JMFS168E01+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMSF046C11+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMFF047P11+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMFF051M03+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMFF047D08+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMFF035I16+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMSF039H17+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMFF001I19+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMFF025E03+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMFF003B02+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
JMSF027C19+ ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
                      ____________________________________________________________
consensus ACTGAAATATGTATCACCGCTCGAAGCTTTACCGGAGATTCTCGAGAATCAAGGAAAGGC
 
. : . : . : . : . : . :
JMFS168E01+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGG
JMSF046C11+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
JMFF047P11+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
JMFF051M03+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
JMFF047D08+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
JMFF035I16+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
JMSF039H17+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
JMFF001I19+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
JMFF025E03+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
JMFF003B02+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
JMSF027C19+ TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
                      ____________________________________________________________
consensus TAGTTACAAGAATCCATGGGGAATAAAAACGAGAAATGGCAGAGAGGAACACTGGAAACC
 
. : . : . : . : . : . :
JMSF046C11+ CT
JMFF047P11+ CTAGCCAAAGCGGCAGAGACTGGGGATTTTATGTGGAGCCTAATCCTAAAACCCTAGTC
JMFF051M03+ CTAGCCAAAGCGGCAGAGACTGGGGATTTTAT
JMFF047D08+ CTAGCCAAAGCGGCAGAGACTGGGGATTTTATGTGGAGCCTAATCCTAAAACCCTAGTC
JMFF035I16+ CTAGCCAAAGCGGCAGAGACTGGGGATTTTATGTGGAGCCTAATCCTAAAACCCTAGTC
JMSF039H17+ CTAGCCAAAGCGGCAGAGACTGGGGATTTTATGTGGAGCCTAATCCTAAAACCCT
JMFF001I19+ CTAGCCAAAGCGGCAGAGACTGGGGATTTTATGTGGAGCCTAATCCTAAAACCCT
JMFF025E03+ CTAGCCAAAGCGGCAGAGACTGGGGATTTTATGTGGAGCCTAATCCTAAAACCCTAGTC
JMFF003B02+ CTAGCCAAAGCGGCAGAGACTGGGGATTTTATGTGGAGCCTAATCCTAAAACCCTAGTC
JMSF027C19+ CTAGCCAAAGCGGCAGAGACTGGGGATTTTATGTGGAGCCTAATCCTAAAACCCTAGTCC
                      ____________________________________________________________
consensus CTAGCCAAAGCGGCAGAGACTGGGGATTTTATGTGGAGCCTAATCCTAAAACCCTAGTCC