Previous Contig 006431:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003O09Sequence309006431 (6)pir|A84670|A846701e-18probable nucleotide-binding protein [imported] - Arabidopsis thaliana>gb:AC00729
JMSF007O03Sequence324006431 (6)pir|A84670|A846704e-23probable nucleotide-binding protein [imported] - Arabidopsis thaliana>gb:AC00729694012869 (5)gb:AE005172_8898461e-39Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006932_153485
JMSF018H08Sequence250006431 (6)pir|A84670|A846705e-19probable nucleotide-binding protein [imported] - Arabidopsis thaliana>gb:AC00729746012869 (5)gb:AE005172_8898464e-46Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006932_153485
JMSF027C18Sequence607006431 (6)pir|A84670|A846706e-43probable nucleotide-binding protein [imported] - Arabidopsis thaliana>gb:AC00729750012869 (5)gb:AE005172_8898462e-47Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006932_153485
JMSF032D24Sequence697006431 (6)pir|A84670|A846702e-67probable nucleotide-binding protein [imported] - Arabidopsis thaliana>gb:AC00729564012869 (5)gb:AE005172_8898463e-13Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006932_153485
JMSF032O08Sequence674006431 (6)pir|A84670|A846703e-75probable nucleotide-binding protein [imported] - Arabidopsis thaliana>gb:AC00729699012869 (5)gb:AE005172_8898462e-34Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006932_153485

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032O08+ TGTTCATCCACTTCTTGTGCATATGCCTCAAGGTCGGGACAGCGGTAAAAGAGGGGGTCC
JMSF032D24+ GGACAGCNGTAAAAGAGGGGGTCC
                      ____________________________________________________________
consensus TGTTCATCCACTTCTTGTGCATATGCCTCAAGGTCGGGACAGCGGTAAAAGAGGGGGTCC
 
. : . : . : . : . : . :
JMSF032O08+ CGAGCATCAACCACCATCACAAGCAAATCACAACGTTCAACCACTCTCCAAAGCTGTCTC
JMSF032D24+ CGAGCATCAACCACCATCACAAGCAAATCACAACGTTCAACCACTCTCCAAAGCTGTCTC
                      ____________________________________________________________
consensus CGAGCATCAACCACCATCACAAGCAAATCACAACGTTCAACCACTCTCCAAAGCTGTCTC
 
. : . : . : . : . : . :
JMSF032O08+ CAAATATCAAGGTTTTTCTCAAATGGAGTTAGGACAAGATTCTCATTCTCCTCAAGTCTC
JMSF032D24+ CAAATATCAAGGTTTTTCTCAAATGGAGTTAGGACAAGATTCTCATTCTCCTCAAGTCTC
JMSF027C18+ CTCAAGTCTC
                      ____________________________________________________________
consensus CAAATATCAAGGTTTTTCTCAAATGGAGTTAGGACAAGATTCTCATTCTCCTCAAGTCTC
 
. : . : . : . : . : . :
JMSF032O08+ GCAAGGCTCCTCCGCCAAATTAGAAAAGCTTGCCTTTCATTGGTATCAAGCTCTTCAACA
JMSF032D24+ GCAAGGCTCCTCCGCCAAATTAGAAAAGCTTGCCTTTCATTGGTATCAAGCTCTTCAACA
JMSF027C18+ GCAAGGCTCCTCCGCCAAATTAGAAAAGCTTGCCTTTCATTGGTATCAAGCTCTTCAACA
                      ____________________________________________________________
consensus GCAAGGCTCCTCCGCCAAATTAGAAAAGCTTGCCTTTCATTGGTATCAAGCTCTTCAACA
 
. : . : . : . : . : . :
JMSF032O08+ GACATTCTAGAATTCCATGGTGGCCTCCGTGGAACATGAAGACTGCTAGCATGCAATTCC
JMSF032D24+ GACATTCTAGAATTCCATGGTGGCCTCCGTGGAACATGAAGACTGCTAGCATGCAATTCC
JMSF027C18+ GACATTCTAGAATTCCATGGTGGCCTCCGTGGAACATGAAGACTGCTAGCATGCAATTCC
                      ____________________________________________________________
consensus GACATTCTAGAATTCCATGGTGGCCTCCGTGGAACATGAAGACTGCTAGCATGCAATTCC
 
. : . : . : . : . : . :
JMSF032O08+ TCCTCTCTCTTTTGCATCTCCCTCCTTTGCTCAGGTGTAACCTCACTATTGCTGGAGCCA
JMSF032D24+ TCCTCTCTCTTTTGCATCTCCCTCCTTTGCTCAGGTGTAACCTCACTATTGCTGGAGCCA
JMSF007O03+ CACTATTGCTGGAGCCA
JMSF027C18+ TCCTCTCTCTTTTGCATCTCCCTCCTTTGCTCAGGTGTAACCTCACTATTGCTGGAGCCA
                      ____________________________________________________________
consensus TCCTCTCTCTTTTGCATCTCCCTCCTTTGCTCAGGTGTAACCTCACTATTGCTGGAGCCA
 
. : . : . : . : . : . :
JMSF032O08+ GAGTCC-AAATTGATGAGAAGGTTAACGGGAGGATGGCGGTCGGAGAAGAGGCGCTGTGC
JMSF032D24+ GAGTCC-AAATTGATGAGAAGGTTAACGGGAGGATGGCGGTCGGAGAAAAGGCGCTGTGC
JMSF007O03+ GAGTCCAAAATTGATGAGAAGGTTAACGGGAGGATGGCGGTCGGAGAAGAGGCGCTGTGC
JMSF027C18+ GAGTCC-AAATTGATGAGAAGGTTAACGGGAGGATGGCGGTCGGAGAAGAGGCGCTGTGC
                      ____________________________________________________________
consensus GAGTCC-AAATTGATGAGAAGGTTAACGGGAGGATGGCGGTCGGAGAAGAGGCGCTGTGC
 
. : . : . : . : . : . :
JMSF032O08+ CTCATCGGCCTGATCGATGACGGCGTCGATGTCGTTGACCTCGGTGACGGACTCGAGAAC
JMSF018H08+ CGGCCTGATCGATGACGGCGTCGATGTCGTTGACCTCGGTGACGGACTCGAGAAC
JMSF032D24+ CTCATCGGCCTGATCGATGACGGCGTCGATGTCGTTGACCTCGGTGACGGACTCGAGAAC
JMSF007O03+ CTCATCGGCCTGATCGATGACGGCGTCGATGTCGTTGACCTCGGTGACGGACTCGAGAAC
JMSF003O09+ GCCTGATCGATGACGGCGTCGATGTCGTTGACCTCGGTGACGGACTCGAGAAC
JMSF027C18+ CTCATCGGCCTGATCGATGACGGCGTCGATGTCGTTGACCTCGGTGACGGACTCGAGAAC
                      ____________________________________________________________
consensus CTCATCGGCCTGATCGATGACGGCGTCGATGTCGTTGACCTCGGTGACGGACTCGAGAAC
 
. : . : . : . : . : . :
JMSF032O08+ CTTTTTGTGCTGGTTCCGGTAAAACCGACCTTTCTCTTTGGTCTGCTGGATCATCTGGTT
JMSF018H08+ CTTTTTGTGCTGGTTCCGGTAAAACCGACCTTTCTCTTTGGTCTGCTGGATCATCTGGTT
JMSF032D24+ CTTTTTGTGCTGGTTCCGGTAAAACCGACCTTTCTCTTTGGTCTGCTGGATCATCTGGTT
JMSF007O03+ CTTTTTGTGCTGGTTCCGGTAAAACCGACCTTTCTCTTTGGTCTGCTGGATCATCTGGTT
JMSF003O09+ CTTTTTGTGCTGGTTCCGGTAAAACCGACCTTTCTCTTTGGTCTGCTGGATCATCTGGTT
JMSF027C18+ CTTTTTGTGCTGGTTCCGGTAAAACCGACCTTTCTCTTTGGTCTGCTGGATCATCTGGTT
                      ____________________________________________________________
consensus CTTTTTGTGCTGGTTCCGGTAAAACCGACCTTTCTCTTTGGTCTGCTGGATCATCTGGTT
 
. : . : . : . : . : . :
JMSF032O08+ GTGGTGCTTCACCAGAGCCCGCCCTAACCCCGTCTTCTCCCCCTTCCCCATTATCCTATA
JMSF018H08+ GTGGTGCTTCACCAGAGCCCGCCCTAACCCCGTCTTCTCCCCCTTCCCCATTATCCTATA
JMSF032D24+ GTGGTGCTTCACCAGAGCCCGCCCTAACCCCGTCTTCTCCCCCTTCCCCATTATCCTATA
JMSF007O03+ GTGGTGCTTCACCAGAGCCCGCCCTAACCCCGTCTTCTCCCCCTTCCCCATTATCCTATA
JMSF003O09+ GTGGTGCTTCACCAGAGCCCGCCCTAACCCCGTCTTCTCCCCCTTCCCCATTATCCTATA
JMSF027C18+ GTGGTGCTTCACCAGAGCCCGCCCTAACCCCGTCTTCTCCCCCTTCCCCATTATCCTATA
                      ____________________________________________________________
consensus GTGGTGCTTCACCAGAGCCCGCCCTAACCCCGTCTTCTCCCCCTTCCCCATTATCCTATA
 
. : . : . : . : . : . :
JMSF032O08+ CCAGAAATGCCTCTATAGAGCTCTCTGTCTATCTCTATACCTCTCTCAATGTGTTTGTGT
JMSF018H08+ CCAGAAATGCCTCTATAGAGCTCTCTGTCTATCTCTATACCTCTCTCAATGTGTTTGTGT
JMSF032D24+ CCAGAAATGCCTCTATAGAGCTCTCTGTCTATCTCTATACCTCTCTCAATGTGTTTGTGT
JMSF007O03+ CCAGAAATGCCTCTATAGAG--CTCTGTCTATCTCTATACCTCTCTCAATGTGTTTGTGT
JMSF003O09+ CCAGAAATGCCTCTATAGAGCTCTCTGTCTATCTCTATACCTCTCTCAATGTGTTTGTGT
JMSF027C18+ CCAGAAATGCCTCTATAGAG--CTCTGTCTATCTCTATACCTCTCTCAATGTGTTTGTGT
                      ____________________________________________________________
consensus CCAGAAATGCCTCTATAGAGCTCTCTGTCTATCTCTATACCTCTCTCAATGTGTTTGTGT
 
. : . : . : . : . : . :
JMSF032O08+ TTTTTCTGATTTTC
JMSF018H08+ TTTTTCTGATTTTC
JMSF032D24+ TTTTTCTGATTTTCAATCTTTCCGAGTAGTGGCGGTAGAGAAATTGGGAACGCCTTCGAG
JMSF007O03+ TTTTTCT
JMSF003O09+ TTTTTCTGATTTTCAATCTTTCCGAGTAGTGGCGGTAGAGAAATTGGGAACGCCTTCGAG
JMSF027C18+ TTTTTCTGATTTTCAATCTTTCCGAGTAGTGGCGGTAGAGAAATTGGGAACGCCTTCGAG
                      ____________________________________________________________
consensus TTTTTCTGATTTTCAATCTTTCCGAGTAGTGGCGGTAGAGAAATTGGGAACGCCTTCGAG
 
. : . : . : . : . : . :
JMSF032D24+ ACGAGGGGAAA
JMSF003O09+ ACGAGGGGAAA
JMSF027C18+ ACGAGGGGAAACAACGGCTGACCGGGACAAGGAAGAAAGAAAAAGATGAAAACCGGTCCC
                      ____________________________________________________________
consensus ACGAGGGGAAACAACGGCTGACCGGGACAAGGAAGAAAGAAAAAGATGAAAACCGGTCCC