Previous Contig 006429:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005I06Sequence438006429 (38)pir|B96771|B967713e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_603006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF006I22Sequence595006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_552006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF014E07Sequence569006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF025O19Sequence526006429 (38)pir|B96771|B967714e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_553006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF026C06Sequence567006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_603006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF029J04Sequence523006429 (38)pir|B96771|B967713e-54protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_666021310pir|B96771|B967715e-54protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF032K17Sequence581006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF033O18Sequence551006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_609006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF033P05Sequence610006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF038G18Sequence569006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_561006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF041F15Sequence615006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_615006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFN005C05Sequence625006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFN007C04Sequence585006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFN009H14Sequence578006429 (38)pir|B96771|B967711e-53protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFN032A21Sequence558006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFN034F14Sequence582006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFN038B16Sequence618006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF009A04Sequence317006429 (38)pir|B96771|B967716e-41protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_555006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF010F02Sequence426006429 (38)pir|B96771|B967713e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_595006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF011C24Sequence410006429 (38)pir|B96771|B967718e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF027B06Sequence588006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_553006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF028B06Sequence551006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF029M17Sequence628006429 (38)pir|B96771|B967717e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_591006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF029O11Sequence627006429 (38)pir|B96771|B967717e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_563006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF035H23Sequence610006429 (38)pir|B96771|B967716e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_561006429 (38)pir|B96771|B967715e-56protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN009H14+ GTGCTGGGACAAAGATAGTAAACAAAAGCATGCGGCAGAAATCATGTGTA
JMFN038B16+ ACTGAAATTTGTGCTGGGACAAAGATAGTAAACAAAAGCATGCGGCAGAAATCATGTGTA
JMFN005C05+ GTGCTGGGACAAAGATAGTAANCAAAAGCATGCGGCAGAAATCATGTGTA
JMSF029O11+ TGCGGCAGAAATCATGTGTA
rJMFF041F15- GCAGAAATCATGTGTA
JMFN034F14+ A
JMFF041F15+ GCAGAAATCATGTGTA
rJMFF033P05- ATGTGTA
rJMFF033O18- TGTGTA
JMSF035H23+ TA
rJMFF026C06- TGTGTA
rJMFF005I06- TGTGTA
JMFN032A21+ A
JMSF029M17+ TGCGGCAGAAATCATGTGTA
                      ____________________________________________________________
consensus ACTGAAATTTGTGCTGGGACAAAGATAGTAAACAAAAGCATGCGGCAGAAATCATGTGTA
 
. : . : . : . : . : . :
JMFN009H14+ AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
JMFN038B16+ AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
JMFN005C05+ AGTACAAAAAATGAGCANAATTAGTTTCATCTAACAAGATGTCCAATGGTTNTGTGCTAC
JMSF029O11+ AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMFF041F15- AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
JMFN034F14+ AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
JMFN007C04+ ACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
JMFF041F15+ AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMFF033P05- AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMFF033O18- AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
JMSF035H23+ AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMFF026C06- AGCACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMFF005I06- AGCACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMSF010F02- AAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMFF032K17- AAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMFF014E07- TCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMFF025O19- ATGGTTTTGTGCTAC
JMFF006I22+ TGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMSF029O11- AAGATGTCCAATGGTTTTGTGCTAC
JMFF038G18+ TCTAACAAGATGTCCAATGGTTTTGTGCTAC
JMFF026C06+ CTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMFF038G18- GATGTCCAATGGTTTTGTGCTAC
JMFN032A21+ AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMSF009A04- AATGGTTTTGTGCTAC
rJMFF006I22- ATGGTTTTGTGCTAC
JMFF033O18+ TGTGCTAC
JMSF029M17+ AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
rJMSF035H23- ATGGTTTTGTGCTAC
rJMSF027B06- GGTTTTGTGCTAC
rJMSF029M17- TTTTGTGCTAC
rJMSF028B06- GTTTTGTGCT-C
JMSF027B06+ GAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
                      ____________________________________________________________
consensus AGTACAAAAAATGAGCAAAATTAGTTTCATCTAACAAGATGTCCAATGGTTTTGTGCTAC
 
. : . : . : . : . : . :
JMFN009H14+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFN038B16+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFN005C05+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMSF029O11+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMFF041F15- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFN034F14+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFN007C04+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFF041F15+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMFF033P05- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMFF033O18- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMSF035H23+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMFF026C06- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMFF005I06- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMSF010F02- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMFF032K17- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMFF014E07- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAAAAAGACACAAATATAACTGG
rJMFF025O19- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFF006I22+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMSF029O11- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFF038G18+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFF026C06+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMFF038G18- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFN032A21+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMSF009A04- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMFF006I22- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFF033O18+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFF025O19+ GAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMFF029J04+ GAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMSF029M17+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMSF035H23- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMSF027B06- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMSF029M17- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
rJMSF028B06- TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
JMSF027B06+ TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
                      ____________________________________________________________
consensus TAAAACAAGGTTGAATGACAAAAGGCACATATGATCAAAACAAGACACAAATATAACTGG
 
. : . : . : . : . : . :
JMFN009H14+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFN038B16+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFN005C05+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMSF029O11+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF041F15- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFN034F14+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFN007C04+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFF041F15+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF033P05- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF033O18- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMSF035H23+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF026C06- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF005I06- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMSF010F02- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF032K17- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF014E07- AGTATGTAGTAAAGACGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF025O19- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFF006I22+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMSF029O11- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFF038G18+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFF026C06+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF038G18- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFN032A21+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMSF009A04- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMFF006I22- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFF033O18+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFF025O19+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFF029J04+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMFF005I06+ TCTTCAAAAGCAACCCACCAT
JMSF029M17+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMSF035H23- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMSF027B06- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMSF029M17- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
rJMSF028B06- AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
JMSF010F02+ CCACCAT
JMSF027B06+ AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
                      ____________________________________________________________
consensus AGTATGTAGTAAAGATGCAGCTACATAAATCACTGGAGATCTTCAAAAGCAACCCACCAT
 
. : . : . : . : . : . :
JMFN009H14+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFN038B16+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFN005C05+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMSF029O11+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF041F15- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFN034F14+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFN007C04+ GATTCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFF041F15+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF033P05- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF033O18- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMSF035H23+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF026C06- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF005I06- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMSF010F02- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF032K17- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF014E07- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF025O19- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFF006I22+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMSF029O11- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFF038G18+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFF026C06+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF038G18- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFN032A21+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMSF009A04- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMFF006I22- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFF033O18+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFF025O19+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFF029J04+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMFF005I06+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMSF011C24+ CATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMSF029M17+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMSF035H23- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMSF027B06- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMSF029M17- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
rJMSF028B06- GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMSF010F02+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
JMSF027B06+ GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
                      ____________________________________________________________
consensus GCATCTTCAACATTCTAGCTTAGATGTTGCTTGGGTACATGAAAACTCTAACCTTGTTAC
 
. : . : . : . : . : . :
JMFN009H14+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFN038B16+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFN005C05+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMSF029O11+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF041F15- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFN034F14+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFN007C04+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFF041F15+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF033P05- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF033O18- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMSF035H23+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF026C06- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF005I06- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMSF010F02- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF032K17- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF014E07- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF025O19- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFF006I22+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMSF029O11- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFF038G18+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFF026C06+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF038G18- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFN032A21+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMSF009A04- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMFF006I22- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFF033O18+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFF025O19+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMFF029J04+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCT---GACGCCACTGTTGCCGT
JMFF005I06+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMSF011C24+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMSF029M17+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMSF035H23- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMSF027B06- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMSF029M17- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
rJMSF028B06- CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMSF010F02+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
JMSF009A04+ CGACGCCACTGTTGCCGT
JMSF027B06+ CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
                      ____________________________________________________________
consensus CCATGGATTTGGGTGGGAGGTTGGACTTGAACTTAGCTCTGACGACGCCACTGTTGCCGT
 
. : . : . : . : . : . :
JMFN009H14+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFN038B16+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFN005C05+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMSF029O11+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF041F15- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFN034F14+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFN007C04+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFF041F15+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF033P05- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF033O18- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMSF035H23+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF026C06- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF005I06- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMSF010F02- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF032K17- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF014E07- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF025O19- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTTTTGGTCTTAG
JMFF006I22+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMSF029O11- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFF038G18+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFF026C06+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF038G18- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFN032A21+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMSF009A04- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMFF006I22- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFF033O18+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFF025O19+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTTTTGGTCTTAG
JMFF029J04+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMFF005I06+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMSF011C24+ GAGGCCTGCAGACCTCTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMSF029M17+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMSF035H23- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMSF027B06- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMSF029M17- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
rJMSF028B06- GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMSF010F02+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMSF009A04+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
JMSF027B06+ GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
                      ____________________________________________________________
consensus GAGGCCTGCAGACCTTTCCCCAGATGCAGCGGTAGTGAGAGCCGCCCTTCTTGGTCTTAG
 
. : . : . : . : . : . :
JMFN009H14+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFN038B16+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFN005C05+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMSF029O11+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF041F15- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFN034F14+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFN007C04+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFF041F15+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF033P05- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF033O18- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMSF035H23+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF026C06- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF005I06- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMSF010F02- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF032K17- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF014E07- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF025O19- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFF006I22+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMSF029O11- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFF038G18+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFF026C06+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF038G18- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFN032A21+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMSF009A04- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMFF006I22- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFF033O18+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFF025O19+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFF029J04+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMFF005I06+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMSF011C24+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMSF029M17+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMSF035H23- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMSF027B06- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMSF029M17- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
rJMSF028B06- CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMSF010F02+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMSF009A04+ CCTNGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
JMSF027B06+ CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
                      ____________________________________________________________
consensus CCTTGTAGACGTAGGCCATGCGCTTTCCCAGGTACCATGCCACTTCCTCCTGGGTGTTCA
 
. : . : . : . : . : . :
JMFN009H14+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFN038B16+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFN005C05+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMSF029O11+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF041F15- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFN034F14+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFN007C04+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFF041F15+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF033P05- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF033O18- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMSF035H23+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF026C06- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF005I06- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMSF010F02- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF032K17- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF014E07- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF025O19- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFF006I22+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMSF029O11- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFF038G18+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFF026C06+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF038G18- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFN032A21+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMSF009A04- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMFF006I22- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFF033O18+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFF025O19+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFF029J04+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMFF005I06+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMSF011C24+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMSF029M17+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMSF035H23- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMSF027B06- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMSF029M17- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
rJMSF028B06- CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMSF010F02+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMSF009A04+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
JMSF027B06+ CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
                      ____________________________________________________________
consensus CTCCTTCGATCTGAATCAGTGAGGTGTTCGGATACTGATTCGACTTCGACCTCTTGTAAC
 
. : . : . : . : . : . :
JMFN009H14+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTC
JMFN038B16+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFN005C05+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMSF029O11+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF041F15- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFN034F14+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFN007C04+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFF041F15+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF033P05- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF033O18- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMSF035H23+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF026C06- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF005I06- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMSF010F02- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF032K17- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF014E07- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF025O19- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFF006I22+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMSF029O11- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFF038G18+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFF026C06+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF038G18- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFN032A21+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMSF009A04- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMFF006I22- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFF033O18+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFF025O19+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFF029J04+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMFF005I06+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMSF011C24+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMSF029M17+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMSF035H23- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMSF027B06- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMSF029M17- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
rJMSF028B06- CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMSF010F02+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMSF009A04+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
JMSF027B06+ CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
                      ____________________________________________________________
consensus CGAGAACCGTTCCTCTAACATACAGTCTGACACGCTCGCCTTGACGTCCTTTCACCATTT
 
. : . : . : . : . : . :
JMFN038B16+ TCACCGTTGGAAGGCGGA
JMFN005C05+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGA
JMSF029O11+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCC
rJMFF041F15- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCT
JMFN034F14+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGA
JMFN007C04+ TCACCGTTGGAAGGCGGAGCAGCTGCGGATAGTGATTCAGAGACCTAA
JMFF041F15+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCT
rJMFF033P05- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCT
rJMFF033O18- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCT
JMSF035H23+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
rJMFF026C06- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCC
rJMFF005I06- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCC
rJMSF010F02- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
rJMFF032K17- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAA
rJMFF014E07- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAAC
rJMFF025O19- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGC
JMFF006I22+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCC
rJMSF029O11- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCC
JMFF038G18+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCT
JMFF026C06+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCC
rJMFF038G18- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCT
JMFN032A21+ TCACCGTTGGAAGGCGG
rJMSF009A04- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
rJMFF006I22- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCC
JMFF033O18+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCT
JMFF025O19+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGC
JMFF029J04+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCT
JMFF005I06+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCC
JMSF011C24+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCT
JMSF029M17+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
rJMSF035H23- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
rJMSF027B06- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
rJMSF029M17- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
rJMSF028B06- TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
JMSF010F02+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
JMSF009A04+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTC
JMSF027B06+ TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTCA
                      ____________________________________________________________
consensus TCACCGTTGGAAGGCGGAGCAGCTGCGGAGAGTGATTCAGAGACCTAAGCTAAACCCTCA