Previous Contig 006422:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006I10Sequence425006422 (7)gb:AP006757_18629277e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055263013016 (8)gb:AP006757_18629271e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055
JMSF013L19Sequence429006422 (7)gb:AP006757_18629271e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055719013016 (8)gb:AP006757_18629279e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055
JMSF015F11Sequence480006422 (7)gb:AP006757_18629271e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055802013016 (8)gb:AP006757_18629275e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055
JMSF026O18Sequence543006422 (7)gb:AP006757_18629273e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055732013016 (8)gb:AP006757_18629273e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055
JMSF036A07Sequence617006422 (7)gb:AP006757_18629272e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055742013016 (8)gb:AP006757_18629271e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055
JMSF039D07Sequence618006422 (7)gb:AP006757_18629276e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055802013016 (8)gb:AP006757_18629273e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055
JMSF041F21Sequence756006422 (7)gb:AP006757_18629271e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055680013016 (8)gb:AP006757_18629277e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P055

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041F21+ AGCGCTGTCTCACTAAGAGTAAGAAAAGCAGTATCATCATTCAGATTTCGGATATATNG
                      ____________________________________________________________
consensus AGCGCTGTCTCACTAAGAGTAAGAAAAGCAGTATCATCATTCAGATTTCGGATATATNG
 
. : . : . : . : . : . :
JMSF041F21+ CTTGCATAGCTCATNTATTTGAGTCCTTAAGCGCTGCAACTCCTCTCTCTTGGTTAAGGT
                      ____________________________________________________________
consensus CTTGCATAGCTCATNTATTTGAGTCCTTAAGCGCTGCAACTCCTCTCTCTTGGTTAAGGT
 
. : . : . : . : . : . :
JMSF036A07+ TCAAAGTCTCGAACCAGGATCTGAGTCAATCTTTTAGCTTC
JMSF041F21+ AAGATTTAATCCATTTCTTTCAAAGTCTCGAACCAGGATCTGAGTCAATCTTTTAGCTTC
JMSF039D07+ TCAAAGTCTCGAACCAGGATCTGAGTCAATCTTTTAGCTTC
                      ____________________________________________________________
consensus AAGATTTAATCCATTTCTTTCAAAGTCTCGAACCAGGATCTGAGTCAATCTTTTAGCTTC
 
. : . : . : . : . : . :
JMSF036A07+ AGTGCTCATCCTGTCTACTCTTGATGCCAGAGCTTTAACAACTCGGTAAACATCTTCACG
JMSF041F21+ AGTGCTCATCCTGTCTACTCTTGANGCCAGAGCTTTAACAACTCGGTAAACATNTTCACG
JMSF039D07+ AGTGCTCATCCTGTNTACTCTTGATGCCAGAGCTTTAACAACTCGGTAAACATCTTCACG
                      ____________________________________________________________
consensus AGTGCTCATCCTGTCTACTCTTGATGCCAGAGCTTTAACAACTCGGTAAACATCTTCACG
 
. : . : . : . : . : . :
JMSF036A07+ TTTACTGCAAATTGAAACATGAGCATCGATTCTTCTCTCTGCTTCAGCACTAGCTTTGCG
JMSF041F21+ TTTACTGCAAATTGAAACATGAGCATCGATTCTTCTCTCTGCTTCAGCACTAGCTTTGCG
JMSF039D07+ TTTACTGCAAATTGAAACATGAGCATCGATTCTTCTCTCTGCTTCAGCACTAGCTTTGCG
JMSF015F11+ GCTTCAGCACTAGCTTTGCG
JMSF026O18+ GCG
                      ____________________________________________________________
consensus TTTACTGCAAATTGAAACATGAGCATCGATTCTTCTCTCTGCTTCAGCACTAGCTTTGCG
 
. : . : . : . : . : . :
JMSF036A07+ AACATCTTCAGAAGTGGAAACCCACTTTGGAAAGAGACANGACTGTATCAGAGGGAANTG
JMSF013L19+ GGAAAGAGACANGACTGTATCAGAGGGAATTG
JMSF006I10+ AGAGACANGACTGTATCAGAGGGAANTG
JMSF041F21+ AACATCTTCAGAAGTGGAAACCCACTTTGGAAAGAGACANGACTGTATCAGAGGGAATTG
JMSF039D07+ AACATCTTCAGAAGTGGAAACCCACTTTGGAAAGAGACANGACTGTATCAGAGGGAANTG
JMSF015F11+ AACATCTTCAGAAGTGGAAACCCACTTTGGAAAGAGACANGACTGTATCAGAGGGAATTG
JMSF026O18+ AACATCTTCAGAAGTGGAAACCCACTTTGGAAAGAGACATGACTGTATCAGAGGGAATTG
                      ____________________________________________________________
consensus AACATCTTCAGAAGTGGAAACCCACTTTGGAAAGAGACATGACTGTATCAGAGGGAATTG
 
. : . : . : . : . : . :
JMSF036A07+ CTCTGCTTCCAATTCTGCCAATGGTAAAACCACATTTGCACAACTGACCTTGTCGAGAGG
JMSF013L19+ CTCTGCTTCCAATTCTGCCAATGGTAAAACCACATTTGCACAACTGACCTTGTCGAGAGG
JMSF006I10+ CTCTGCTTCCAATTCTGCCAATGGTAAAACCACATTTGCACAACTGACCTTGTCGAGAGG
JMSF041F21+ CTCTGCTTCCAATTCTGCCAATGGTAAAACCACATTTGCACAACTGACCTTGTCGAGAGG
JMSF039D07+ CTCTGCTTCCAATTCTGCCAATGGTAAAACCACATTTGCACAACTGACCTTGTCGAGAGG
JMSF015F11+ CTCTGCTTCCAATTCTGCCAATGGTAAAACCACATTTGCACAACTGACCTTGTCGAGAGG
JMSF026O18+ CTCTGCTTCCAATTCTGCCAATGGTAAAACCACATTTGCACAACTGACCTTGTCGAGAGG
                      ____________________________________________________________
consensus CTCTGCTTCCAATTCTGCCAATGGTAAAACCACATTTGCACAACTGACCTTGTCGAGAGG
 
. : . : . : . : . : . :
JMSF036A07+ AACAGAAGCAACTGCATCGTGAACCTGCTTCGATTTGGCAANTATGTGGTCGGCTAATCT
JMSF013L19+ AACAGAAGCAACTGCATCGTGAACCTGCTTCGATTTGGCAATTATGTGGTCGGCTAATCT
JMSF006I10+ AACAGAAGCAACTGCATCGTGAACCTGCTTCGATTTGGCAATTATGTGGTCGGCTAATCT
JMSF041F21+ AACAGAAGCAANTGCATCGTGAACCTGCTTCGATTTGGCAATTATGTGGTCGGCTAATCT
JMSF039D07+ AACAGAAGCAACTGCATCGTGAACCTGCTTCGATTTGGCAATTATGTGGTCGGNTAATCT
JMSF015F11+ AACAGAAGCAACTGCATCGTGAACCTGCTTCGA-TTGGCAANTATGTGGTCGGNTAATCT
JMSF026O18+ AACAGAAGCAACTGCATCGTGAACCTGCTTCGATTTGGCAATTATGTGGTCGGCTAATCT
                      ____________________________________________________________
consensus AACAGAAGCAACTGCATCGTGAACCTGCTTCGATTTGGCAATTATGTGGTCGGCTAATCT
 
. : . : . : . : . : . :
JMSF036A07+ CAGAATCTCGGAAGCAGATAGATTTACTCGAACATTTAACCCCGGTATCTCTTTTCTCTT
JMSF013L19+ CAGAATCTCGGAAGCAGATAGATTTACTCGAACATTTAACCCCGGTATCTCTTTTCTCTT
JMSF006I10+ CAGAATCTCGGAAGCAGATAGATTTACTCGAACATTTAACCCCGGTATCTCTTTTCTCTT
JMSF041F21+ CAGAATCTCGGAAGCAGATAGATTTACTCGAACATTTAACCCCGGTATCTCTTTTCTCTT
JMSF039D07+ CAGAATCTCGGAAGCAGATAGATTTACTCGAACATTTAACCCCGGTATCTCTTTTCTCTT
JMSF015F11+ CAGAATCTCGGAAGCAGATAGATTTACTCGAACATTTAACCCCGGTATCTCTTTTCTCTT
JMSF026O18+ CAGAATCTCGGAAGCAGATAGATTTACTCGAACATTTAACCACGGTATCTCTTTTCTCTT
                      ____________________________________________________________
consensus CAGAATCTCGGAAGCAGATAGATTTACTCGAACATTTAACCCCGGTATCTCTTTTCTCTT
 
. : . : . : . : . : . :
JMSF036A07+ GCGATTCCTCTTGTGAGAGTTGAAAGCTGTGATGGCGAAGTTGACGGCGACGGCGAGAAG
JMSF013L19+ GCGATTCCTCTTGTGAGAGTTGAAAGCTGTGATGGCGAAGTTGACGGCGACGGCGAGAAG
JMSF006I10+ GCGATTCCTCTTGTGAGAGTTGAAAGCTGTGATGGCGAAGTTGACGGCGACGGCGAGAAG
JMSF041F21+ GCGATTCCTCTTGTGAGAGTTGAAAGCTGTGATGGCGAAGTTGACGGCGACGGCGAGAAG
JMSF039D07+ GCGATTCCTCTTGTGAGAGTTGAAAGCTGTGATGGCGAAGTTGACGGCGACGGCGAGAAG
JMSF015F11+ GCGATTCCTCTTGTGAGAGTTGAAAGCTGTGATGGCGAAGTTGACGGCGACGGCGAGAAG
JMSF026O18+ GCGATTCCTCTTGTGAGAGNTGAAAGCTGTGATGGCGAAGTTGACGGCGACGGCGAGAAG
                      ____________________________________________________________
consensus GCGATTCCTCTTGTGAGAGTTGAAAGCTGTGATGGCGAAGTTGACGGCGACGGCGAGAAG
 
. : . : . : . : . : . :
JMSF036A07+ AGCAGCGGCGCCGGTGATAGCAATGAGCTTTTGCTTCTCCCTTTTCTGCTTTGCCTCCAT
JMSF013L19+ AGCAGCGGCGCCGGTGATAGCAATGAGCTTTTGCTTCTCCCTTTTCTGCTTTGCCTCCAT
JMSF006I10+ AGCAGCGGCGCCGGTGATAGCAATGAGCTTTTGCTTCTCCCTTTTCTGCTTTGCCTCCAT
JMSF041F21+ AGCAGCGGCGCCGGTGATAGCAATGAGCTTTTGCTTCTCCCTTTTCTGCTTTGCCTCCAT
JMSF039D07+ AGCAGCGGCGCCGGTGATAGCAATGAGCTTTTGCTTCTCCCTTTTCTGCTTTGCCTCCAT
JMSF015F11+ AGCAGCGGCGCCGGTGATAGCAATGAGCTTTTGCTTCTCCCTTTTCTGCTTTGCCTCCAT
JMSF026O18+ AGCAGCGGCGCCGGTGATAGCAANGAGCTTTTGCTTCTCCCTTTTCTGCTTTGCCTCCAT
                      ____________________________________________________________
consensus AGCAGCGGCGCCGGTGATAGCAATGAGCTTTTGCTTCTCCCTTTTCTGCTTTGCCTCCAT
 
. : . : . : . : . : . :
JMSF036A07+ TCTCACTGTGCTTCGTCTTCCGCAAGCTGCCAAGACCTCAAACCCTCTTTCACAGTCTCT
JMSF013L19+ TCTCACTGTGCTTCGTCTTCCGCAAGCTGCCAAAACCTCAAACCCTCTTTCACAGTCTCT
JMSF006I10+ TCTCACTGTGCTTCGTCTTCCGCAAGCTGCCAAAACCTCAAACCCTCTTTCACAGTCTCT
JMSF041F21+ TCTCACTGTGCTTCGTCTTCCGCAAGCTGCCAAAACCTCAAACCCTCTTTCACAGTCTCT
JMSF039D07+ TCTCACTGTGCTTCGTCTTCCGCAAGCTGCCAAAACCTCAAACCCTCTTTCACAGTCTCT
JMSF015F11+ TCTCACTGTGCTTCGTCTTCCGCAAGCTGCCAAAACCTCAAACCCTCTTTCACAGTCTCT
JMSF026O18+ TCTCACTGTGCTTCGTCTTCCGCAAGCTGCCAAAACCTCAAACCCTCTTTCACAGTCTCT
                      ____________________________________________________________
consensus TCTCACTGTGCTTCGTCTTCCGCAAGCTGCCAAAACCTCAAACCCTCTTTCACAGTCTCT
 
. : . : . : . : . : . :
JMSF036A07+ CTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCTCC
JMSF013L19+ CTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCTCC
JMSF006I10+ CTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCTCC
JMSF041F21+ CTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCTCCACC
JMSF039D07+ CTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCTCCACC
JMSF015F11+ CTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCTCCACC
JMSF026O18+ CTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCTCCACCCTTAGCGGCAAATGCAAGGAGGG
                      ____________________________________________________________
consensus CTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCTCCACCCTTAGCGGCAAATGCAAGGAGGG
 
. : . : . : . : . : . :
JMSF026O18+ AAATTTTATGTATGCTCTGAAGTGGCGGACTCGGGAAAGTGGACCTTTCAACGTCCGACC
                      ____________________________________________________________
consensus AAATTTTATGTATGCTCTGAAGTGGCGGACTCGGGAAAGTGGACCTTTCAACGTCCGACC