Previous Contig 006415:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026N14Sequence647006415 (3)pir|C84553|C845532e-64probable protein kinase [imported] - Arabidopsis thaliana>gb:AC007584_1535971 Ar741023244pir|C84553|C845532e-26probable protein kinase [imported] - Arabidopsis thaliana>gb:AC007584_1535971 Ar
JMSF029E05Sequence639006415 (3)pir|C84553|C845532e-64probable protein kinase [imported] - Arabidopsis thaliana>gb:AC007584_1535971 Ar735012640 (2)
JMSF041L09Sequence770006415 (3)pir|C84553|C845532e-85probable protein kinase [imported] - Arabidopsis thaliana>gb:AC007584_1535971 Ar818012640 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041L09+ GAAGAATGGGGGTATTTCCAGATTTTATTGGATCTTTGGCAGGATTAATGGTG
                      ____________________________________________________________
consensus GAAGAATGGGGGTATTTCCAGATTTTATTGGATCTTTGGCAGGATTAATGGTG
 
. : . : . : . : . : . :
JMSF041L09+ GAACAGAGCAGGATATTTTCAAGTTTTAGGTCTGTATGTATAATTCCAAGTACTCTATGC
                      ____________________________________________________________
consensus GAACAGAGCAGGATATTTTCAAGTTTTAGGTCTGTATGTATAATTCCAAGTACTCTATGC
 
. : . : . : . : . : . :
JMSF029E05+ CAGTCAAAATGCACTTGCATATTTCTCTAACTTTGTTTAACTCAAGG
JMSF041L09+ AAATAATCTAGGCCAGTCAAAATGCACTTGCATATTTCTCTAACTTTGTTTAACTCAAGG
JMSF026N14+ CAGTCAAAATGCACTTGCATATTTCTCTAACTTTGTTTAACTCAAGG
                      ____________________________________________________________
consensus AAATAATCTAGGCCAGTCAAAATGCACTTGCATATTTCTCTAACTTTGTTTAACTCAAGG
 
. : . : . : . : . : . :
JMSF029E05+ CCTTTATGATGGTTATATCTGATCAGTCGCAACAAACTATCACCAAGAAATTCAAGAACC
JMSF041L09+ CCTTTATGATGGTTATATCTGATCAGTCGCAACAAACTATCACCAAGAAATTCAAGAACC
JMSF026N14+ CCTTTATGATGGTTATATCTGATCAGTCGCAACAAACTATCACCAAGAAATTCAAGAACC
                      ____________________________________________________________
consensus CCTTTATGATGGTTATATCTGATCAGTCGCAACAAACTATCACCAAGAAATTCAAGAACC
 
. : . : . : . : . : . :
JMSF029E05+ ATGCAGAGATGCTGTCCATTTGGGCCTGTGTGCTTAAAATGGTCAATTAACCGTATAACA
JMSF041L09+ ATGCAGAGATGCTGTCCATTTGGGCCTGTGTGCTTAAAATGGTCAATTAACCGTATAACA
JMSF026N14+ ATGCAGAGATGCTGTCCATTTGGGCCTGTGTGCTTAAAATGGTCAATTAACCGTATAACA
                      ____________________________________________________________
consensus ATGCAGAGATGCTGTCCATTTGGGCCTGTGTGCTTAAAATGGTCAATTAACCGTATAACA
 
. : . : . : . : . : . :
JMSF029E05+ CAATTATTATTGGAGGGATCACCATCAGCAATAGCAGAGAGGATTTCAATTTCATGGAGA
JMSF041L09+ CAATTATTATTGGAGGGATCACCATCAGCAATAGCAGAGAGGATTTCAATTTCATGGAGA
JMSF026N14+ CAATTATTATTGGAGGGATCACCATCAGCAATAGCAGAGAGGATTTCAATTTCATGGAGA
                      ____________________________________________________________
consensus CAATTATTATTGGAGGGATCACCATCAGCAATAGCAGAGAGGATTTCAATTTCATGGAGA
 
. : . : . : . : . : . :
JMSF029E05+ GCAGCTTGAGCAAATTGTGGTGCACTCTTCTGAATCTTCAAAGCTACATATGTTGATGCT
JMSF041L09+ GCAGCTTGAGCAAATTGTGGTGCACTCTTCTGAATCTTCAAAGCTACATATGTTGATGCT
JMSF026N14+ GCAGCTTGAGCAAATTGTGGTGCACTCTTCTGAATCTTCAAAGCTACATATGTTGATGCT
                      ____________________________________________________________
consensus GCAGCTTGAGCAAATTGTGGTGCACTCTTCTGAATCTTCAAAGCTACATATGTTGATGCT
 
. : . : . : . : . : . :
JMSF029E05+ TGAGTATCATAGGCGAGCCAGACAGTGGAGAACTCTCCCCAGCCGAGCTTCCGCTGCGCG
JMSF041L09+ TGAGTATCATAGGCGAGCCAGACAGTGGAGAACTCTCCCCAGCCGAGCTTCCGCTGCGCG
JMSF026N14+ TGAGTATCATAGGCGAGCCAGACAGTGGAGAACTCTCCCCAGCCGAGCTTCCGCTGCGCG
                      ____________________________________________________________
consensus TGAGTATCATAGGCGAGCCAGACAGTGGAGAACTCTCCCCAGCCGAGCTTCCGCTGCGCG
 
. : . : . : . : . : . :
JMSF029E05+ ATGTACCGGCCGCCGGCGAAGGAATCGCCGACGCGCACCGCGTGGTACCCTCCCTTCCTG
JMSF041L09+ ATGTACCGGCCGCCGGCGAAGGAATCGCCGACGCGCACCGCGTGGTACCCTCCCTTCCTG
JMSF026N14+ ATGTACCGGCCGCCGGCGAAGGAATCGCCGACGCGCACCGCGTGGTACCCTCCCTTCCTG
                      ____________________________________________________________
consensus ATGTACCGGCCGCCGGCGAAGGAATCGCCGACGCGCACCGCGTGGTACCCTCCCTTCCTG
 
. : . : . : . : . : . :
JMSF029E05+ TACGAGTCCATTGACTCATCCTCCTCCTCCGACCCCGAAGACGACGATGAGCACGACATC
JMSF041L09+ TACGAGTCCATTGACTCATCCTCCTCCTCCGACCCCGAAGACGACGATGAGCACGACATC
JMSF026N14+ TACGAGTCCATTGACTCATCCTCCTCCTCCGACCCCGAAGACGACGATGAGCACGACATC
                      ____________________________________________________________
consensus TACGAGTCCATTGACTCATCCTCCTCCTCCGACCCCGAAGACGACGATGAGCACGACATC
 
. : . : . : . : . : . :
JMSF029E05+ GTGGTTATCCAAATCCGAATCAAAACACCGTGATCTGCCTAAAAGTTTCCCCTCTGAAAT
JMSF041L09+ GTGGTTATCCAAATCCGAATCAAAACACCGTGATCTGCCTAAAAGTTTCCCCTCTGAAAT
JMSF026N14+ GTGGTTATCCAAATCCGAATCAAAACACCGTGATCTGCCTAAAAGTTTCCCCTCTGAAAT
                      ____________________________________________________________
consensus GTGGTTATCCAAATCCGAATCAAAACACCGTGATCTGCCTAAAAGTTTCCCCTCTGAAAT
 
. : . : . : . : . : . :
JMSF029E05+ GAATTCGCTCGCGATCAAATTCGAATTATTTGAATACTGGCGATTGTACAATTACAAATA
JMSF041L09+ GAATTCGCTCGCGATCAAATTCGAATTATTTGAATACTGGCGATTGTACAATTACAAATA
JMSF026N14+ GAATTCGCTCGCGATCAAATTCGAATTATTTGAATACTGGCGATTGTACAATTACAAATA
                      ____________________________________________________________
consensus GAATTCGCTCGCGATCAAATTCGAATTATTTGAATACTGGCGATTGTACAATTACAAATA
 
. : . : . : . : . : . :
JMSF029E05+ CTGTTACAGTTATACGGATGGGGAAGAAAGTTATATGTGCAAGTATCGGT
JMSF041L09+ CTGTTACAGTTATACGGATGGGGAAGAAAGTTATATGTGCAAGTATCGGT
JMSF026N14+ CTGTTACAGTTATACGGATGGGGAAGAAAGTTATATGTGCAAGTATCGGTGAAGCCGAGC
                      ____________________________________________________________
consensus CTGTTACAGTTATACGGATGGGGAAGAAAGTTATATGTGCAAGTATCGGTGAAGCCGAGC