Previous Contig 006411:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007O18Sequence400001575 (62)gb:AF149251_17725021e-54Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.764006411 (4)gb:AY043232_15609821e-85Vitis vinifera pectin methylesterase mRNA, complete cds.
JMFF011I07Sequence521000607 (2)sp|Q43062|PME_PRUPE1e-04Pectinesterase PPE8B precursor (EC 3.1.1.11) (Pectin methylesterase) (PE).>gb:PP399006411 (4)gb:AY043232_15609825e-48Vitis vinifera pectin methylesterase mRNA, complete cds.
JMFN012L02Sequence602006411 (4)gb:AY043232_15609824e-57Vitis vinifera pectin methylesterase mRNA, complete cds.
JMSF026M21Sequence649006411 (4)sp|Q43062|PME_PRUPEe-100Pectinesterase PPE8B precursor (EC 3.1.1.11) (Pectin methylesterase) (PE).>gb:PP

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN012L02+ AATAACACCCCAATTGCGATGCACTCTTTA
rJMFF007O18- TTGCGATGCACTCTTTA
                      ____________________________________________________________
consensus AATAACACCCCAATTGCGATGCACTCTTTA
 
. : . : . : . : . : . :
JMFN012L02+ CTAGACTCAATTCAACTCCAGCTAATATCAAACTAAGCAATTATGGAAGAACGTGGAGGC
rJMFF007O18- CTAGACCCAATTCAACTCCAGCTAATATCAAACTAAGCAATTATGGAAGAACGTGGAGGC
                      ____________________________________________________________
consensus CTAGACTCAATTCAACTCCAGCTAATATCAAACTAAGCAATTATGGAAGAACGTGGAGGC
 
. : . : . : . : . : . :
JMFN012L02+ GAGGGGAATTCTCCATCAATGTCACCCTCCATGAAAGGTAACCAAGAATTTAAAATTTAA
rJMFF007O18- GAGGGGAATTCTCCATCAATGTCACCCTCCATGAAAGGTAACCAAGAATTTAAAATTTAA
                      ____________________________________________________________
consensus GAGGGGAATTCTCCATCAATGTCACCCTCCATGAAAGGTAACCAAGAATTTAAAATTTAA
 
. : . : . : . : . : . :
rJMFF011I07- AAAATGGACANNGGCANATGAACCGTACTTAAACCGNTAAACCGG
JMFN012L02+ ATACCATAAATGAATAAAATGGACAGTGGCAGATGAACCGTACTTAAACCGTTAAACCGG
rJMFF007O18- ATACCATAAATGAATAAAATGGACAGTGGCAGATGAACCGTACTTAAACCGTTAAACCGG
                      ____________________________________________________________
consensus ATACCATAAATGAATAAAATGGACAGTGGCAGATGAACCGTACTTAAACCGTTAAACCGG
 
. : . : . : . : . : . :
rJMFF011I07- CCGCGTATTTCACACCGGTCGAGGGCAACCACGAGTTGCCCAAAATGAACTCGGNCACCG
JMFN012L02+ CCGCGTATTTCACACCGGTCGAGGGCAACCACGAGTTGCCCAAAATGAACTCGGCCACCG
rJMFF007O18- CCGCGTATTTCACACCGGTCGAGGGCAACCACGAGTTGCCCAAAATGAACTCGGCCACCG
JMSF026M21+ ACACCGGTCGAGGGCAACCACGAGTTGCCCAAAATGAACTCGGCCACCG
                      ____________________________________________________________
consensus CCGCGTATTTCACACCGGTCGAGGGCAACCACGAGTTGCCCAAAATGAACTCGGCCACCG
 
. : . : . : . : . : . :
rJMFF011I07- NGAAATTATGGGCCTGGGCCGATTCATTCATAAGGTGGTAACCGGGCCACTTCACTCGGN
JMFN012L02+ TGAAATTATGGGCCTGGGCCGATTCATTCATAAGGTGGTAACCGGGCCACTTCACTCGGT
rJMFF007O18- TGAAATTATGGGCCTGGGCCGATTCATTCATAAGGTGGTAACCGGGCCACTTCACTCGGT
JMSF026M21+ TGAAATTATGGGCCTGGGCCGATTCATTCATAAGGTGGTAACCGGGCCACTTCACTCGGT
                      ____________________________________________________________
consensus TGAAATTATGGGCCTGGGCCGATTCATTCATAAGGTGGTAACCGGGCCACTTCACTCGGT
 
. : . : . : . : . : . :
rJMFF011I07- TGCCCANACCCGCACCGGGCCCGTAGTTTGAAAATTCCCCATAAAACAGCGAGCCCAATG
JMFN012L02+ TGCCCAAACCCGCACCGGGCCCGTAGTTTGAAAATTCCCCATAAAACAGCGAGCCCAATG
rJMFF007O18- TGCCCAAACCCGCACCGGGCCCGTAGTTTGAAAATTCCCCATAAAACAGCGAGCCCAATG
JMSF026M21+ TGCCCAAACCCGCACCGGGCCCGTAGTTTGAAAATTCCCCATAAAACAGCGAGCCCAATG
                      ____________________________________________________________
consensus TGCCCAAACCCGCACCGGGCCCGTAGTTTGAAAATTCCCCATAAAACAGCGAGCCCAATG
 
. : . : . : . : . : . :
rJMFF011I07- CATAATCCCCGTCCCATTCCAGCCACCCTTCGGGCCGGATCGCGCGGCTAATGTACGATT
JMFN012L02+ CATAATCCCCATCCCATTCCAGCCACCCTTCGGGCCGGATCGCGCGGCTAATGTACGATT
rJMFF007O18- CATAATCCCCATCCCATTCCAGCCACCCTTCGGGCCGGATCGCGCGGCTAATGTACGATT
JMSF026M21+ CATAATCCCCATCCCATTCCAGCCACCCTTCGGGCCGGATCGCGCGGCTAATGTACGATT
                      ____________________________________________________________
consensus CATAATCCCCATCCCATTCCAGCCACCCTTCGGGCCGGATCGCGCGGCTAATGTACGATT
 
. : . : . : . : . : . :
rJMFF011I07- GCATGAAAACCGTGCGTGAATAAAGCTTCCACGGNCGGNCGAGGTACGAGGAGGTGGAGT
JMFN012L02+ GCATGAAAACCGTGCGTGAATAAAGCTTCCACGGGCGGCCGAGGTACGAGGAGGTGGAGT
rJMFF007O18- GCATGAAAACCGTGCGTGAATAAAGCTTCCACGGGCGGCCGAGGTACGAGGAGGTGGAGT
JMSF026M21+ GCATGAAAACCGTGCGTGAATAAAGCTTCCACGGGCGGCCGAGGTACGAGGAGGTGGAGT
                      ____________________________________________________________
consensus GCATGAAAACCGTGCGTGAATAAAGCTTCCACGGGCGGCCGAGGTACGAGGAGGTGGAGT
 
. : . : . : . : . : . :
rJMFF011I07- TTCCGGCNGCCAGCAACTCCGGCTCCGCCGNGATGTTACNGAATTGGATGGA
JMFN012L02+ TTCCGGCAGCCAGCAACTCCGGCTCCGCCGTGATGTTACAGAATTGGATGGAGAATCCGG
rJMFF007O18- TTCCGGCAGCCAGCAACTCCGGCTCCGCCGTGATGTTACAGAATTGGATGGAGAATCCGG
JMSF026M21+ TTCCGGCAGCCAGCAACTCCGGCTCCGCCGTGATGTTACAGAATTGGATGGAGAATCCGG
                      ____________________________________________________________
consensus TTCCGGCAGCCAGCAACTCCGGCTCCGCCGTGATGTTACAGAATTGGATGGAGAATCCGG
 
. : . : . : . : . : . :
JMFN012L02+ TGGGTTCCGCCGGGTCTTTCCGGCCGTGCGCG
rJMFF007O18- TGGGTTCCGCCGGGTCTTTCCGGCCGTGCGCGGTGATTGTGTTCTTTTGATTGGGGAGGC
JMSF026M21+ TGGGTTCCGCCGGGTCTTTCCGGCCGTGCGCGGTGATTGTGTTCTTTTGATTGGGGAGGC
                      ____________________________________________________________
consensus TGGGTTCCGCCGGGTCTTTCCGGCCGTGCGCGGTGATTGTGTTCTTTTGATTGGGGAGGC
 
. : . : . : . : . : . :
rJMFF007O18- CCTTTCTGGCTGAGATTTCGCAGTTCTGGAACACCGCCGTGCTGTCGCCGAANATGAAGT
JMSF026M21+ CCTTTCTGGCTGAGATTTCGCAGTTCTGGAACACCGCCGTGCTGTCGCCGAAGATGAAGT
                      ____________________________________________________________
consensus CCTTTCTGGCTGAGATTTCGCAGTTCTGGAACACCGCCGTGCTGTCGCCGAAGATGAAGT
 
. : . : . : . : . : . :
rJMFF007O18- CTACCGTGCCGGTGATCTTGCACTCCCGGTANAACTGTCGCATGGAGTGCGCGTANAGCG
JMSF026M21+ CTACCGTGCCGGTGATCTTGCACTCCCGGTAGAACTGTCGCATGGAGTGCGCGTAGAGCG
                      ____________________________________________________________
consensus CTACCGTGCCGGTGATCTTGCACTCCCGGTAGAACTGTCGCATGGAGTGCGCGTAGAGCG
 
. : . : . : . : . : . :
rJMFF007O18- TGTCTTGGTANCCCCTTATTGCACACC
JMSF026M21+ TGTCTTGGTAGCCCCTTATTGCACACCGGAATAGCACCGACAAATCGGAATCTGACCGGA
                      ____________________________________________________________
consensus TGTCTTGGTAGCCCCTTATTGCACACCGGAATAGCACCGACAAATCGGAATCTGACCGGA
 
. : . : . : . : . : . :
JMSF026M21+ ATGCCACCGCCTGGTGTTTTTCCGGCCCCGCCGTGTTCTCAAATGTCACGTCGCGTGCTC
                      ____________________________________________________________
consensus ATGCCACCGCCTGGTGTTTTTCCGGCCCCGCCGTGTTCTCAAATGTCACGTCGCGTGCTC