Previous Contig 006407:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS032C06Sequence613006407 (2)
JMSF026M13Sequence654006407 (2)761023241gb:AC124142_17404112e-28Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0015A05, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS032C06+ TTTCTTGCTCAACTTTGAGGGTGTTCAGACATTTCACACTTG
                      ____________________________________________________________
consensus TTTCTTGCTCAACTTTGAGGGTGTTCAGACATTTCACACTTG
 
. : . : . : . : . : . :
JMFS032C06+ GAAAACCAAAACTCAGAAATTTTTAGGTGATGCTCGACTTCTACTGNAATCATTTCAATT
                      ____________________________________________________________
consensus GAAAACCAAAACTCAGAAATTTTTAGGTGATGCTCGACTTCTACTGNAATCATTTCAATT
 
. : . : . : . : . : . :
JMFS032C06+ CCCGTGTTTTCTCCGGGGCATGTTTTTGAGCACCGGAAACTGATGCAGGTGGATTAATTC
                      ____________________________________________________________
consensus CCCGTGTTTTCTCCGGGGCATGTTTTTGAGCACCGGAAACTGATGCAGGTGGATTAATTC
 
. : . : . : . : . : . :
JMFS032C06+ ACGAAGATTTCAAAAGGTTCTTTAAAATTAAGATCTCTTAAGACAGTGGAGCAAACCAGT
                      ____________________________________________________________
consensus ACGAAGATTTCAAAAGGTTCTTTAAAATTAAGATCTCTTAAGACAGTGGAGCAAACCAGT
 
. : . : . : . : . : . :
JMFS032C06+ CAATATAGAGGATTCATTATCGTGACTCGTGAGATCAAGAAAAGTGTGTTCATGCCTGAA
                      ____________________________________________________________
consensus CAATATAGAGGATTCATTATCGTGACTCGTGAGATCAAGAAAAGTGTGTTCATGCCTGAA
 
. : . : . : . : . : . :
JMFS032C06+ TTGTGAGAAGTCAATGGTGGATTGGCCGAGGAGAAGAAACCATGGATGTCTGTCTGTTCA
                      ____________________________________________________________
consensus TTGTGAGAAGTCAATGGTGGATTGGCCGAGGAGAAGAAACCATGGATGTCTGTCTGTTCA
 
. : . : . : . : . : . :
JMFS032C06+ TGCCTCGATCTGGATGAAAAGAAGCAGATCTAAAATGATCGGCCAGCCTAGGGTATCACA
                      ____________________________________________________________
consensus TGCCTCGATCTGGATGAAAAGAAGCAGATCTAAAATGATCGGCCAGCCTAGGGTATCACA
 
. : . : . : . : . : . :
JMFS032C06+ GAACACCACTCTGTGAACTCCTTATCTGATATGAGTAGGCCTATTGAGTAGTGGCATTTC
JMSF026M13+ CACTCTGTGAACTCCTTATCTGATATGAGTAGGCCTATTGAGTAGTGGCATTTC
                      ____________________________________________________________
consensus GAACACCACTCTGTGAACTCCTTATCTGATATGAGTAGGCCTATTGAGTAGTGGCATTTC
 
. : . : . : . : . : . :
JMFS032C06+ GGCTTTTTATTCGATGAGCAAATTGACACTCATCCATACATCCAAGTTCAGATCATACTG
JMSF026M13+ GGCTTTTTATTCGATGAGCAAATTGACACTCATCCATACATCCAAGTTCAGATCATACTG
                      ____________________________________________________________
consensus GGCTTTTTATTCGATGAGCAAATTGACACTCATCCATACATCCAAGTTCAGATCATACTG
 
. : . : . : . : . : . :
JMFS032C06+ GGCCAGATTCCTTGAAAAGTGATCCGCTAAAACAACCCATATGGAAAGACTGCAGAATAG
JMSF026M13+ GGCCAGATTCCTTGAAAAGTGATCCGCTAAAACAACCCATATGGAAAGACTGCAGAATAG
                      ____________________________________________________________
consensus GGCCAGATTCCTTGAAAAGTGATCCGCTAAAACAACCCATATGGAAAGACTGCAGAATAG
 
. : . : . : . : . : . :
JMFS032C06+ GCACTGAAAGAAGACTTTGCATGACTTATTC
JMSF026M13+ GCACTGAAAGAAGACTTTGCATGACTTATTCCATGGCTTTATAACACATAGATATTCTTA
                      ____________________________________________________________
consensus GCACTGAAAGAAGACTTTGCATGACTTATTCCATGGCTTTATAACACATAGATATTCTTA
 
. : . : . : . : . : . :
JMSF026M13+ AGCCTCTTTCCATTTCAGGGCACATAGAATGCATGTGGGGCTATGACAGGTTACCCTGCC
                      ____________________________________________________________
consensus AGCCTCTTTCCATTTCAGGGCACATAGAATGCATGTGGGGCTATGACAGGTTACCCTGCC
 
. : . : . : . : . : . :
JMSF026M13+ ACGAGAAAGAATGGAAAAAGCAGCAAGAAGAACCAACATGATGTCTTTGCACCAAAAATC
                      ____________________________________________________________
consensus ACGAGAAAGAATGGAAAAAGCAGCAAGAAGAACCAACATGATGTCTTTGCACCAAAAATC
 
. : . : . : . : . : . :
JMSF026M13+ AGCTAGATATCTTACTTAAAAGCCACAAGGCTCCTCAGAGGACTTGAAGGAGTAATCTTT
                      ____________________________________________________________
consensus AGCTAGATATCTTACTTAAAAGCCACAAGGCTCCTCAGAGGACTTGAAGGAGTAATCTTT
 
. : . : . : . : . : . :
JMSF026M13+ GGGAAGAAATCTGTCTTCAAAAACCATGCCATAGAAGGCAGATAAATGTGTCAACAAAAC
                      ____________________________________________________________
consensus GGGAAGAAATCTGTCTTCAAAAACCATGCCATAGAAGGCAGATAAATGTGTCAACAAAAC
 
. : . : . : . : . : . :
JMSF026M13+ TCTTCCTTATTGAGGAGCGAGAAACTGGAGAGAGAAAGATAAAATTAGGGTTTTAGAGGG
                      ____________________________________________________________
consensus TCTTCCTTATTGAGGAGCGAGAAACTGGAGAGAGAAAGATAAAATTAGGGTTTTAGAGGG
 
. : . : . : . : . : . :
JMSF026M13+ AGAAAATGGACGAAAGAGAAGGGTTTTTGAGGGTTTTGGTTAGAGGGGAGGGTATGGATA
                      ____________________________________________________________
consensus AGAAAATGGACGAAAGAGAAGGGTTTTTGAGGGTTTTGGTTAGAGGGGAGGGTATGGATA
 
. : . : . : . : . : . :
JMSF026M13+ GAATGGAAAATCGAATTCCTTCTCTCACTATGTCGCCGCTGCGGTGGACAGTGAAATCCC
                      ____________________________________________________________
consensus GAATGGAAAATCGAATTCCTTCTCTCACTATGTCGCCGCTGCGGTGGACAGTGAAATCCC