Previous Contig 006403:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007N10Sequence267018543759006403 (5)gb:AK176637_18186253e-70Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-17-H18.
JMSF011A03Sequence266006403 (5)gb:AK176637_18186253e-28Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-17-H18.466006403 (5)gb:AK176637_18186253e-28Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-17-H18.
JMSF026L23Sequence516006403 (5)gb:AK176637_18186254e-28Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-17-H18.466006403 (5)gb:AK176637_18186253e-28Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-17-H18.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007N10+ CCAAGCAAAATATCAAAGCTTGCGATTCTGAACAGTCCGTTAACACCTTCATC
                      ____________________________________________________________
consensus CCAAGCAAAATATCAAAGCTTGCGATTCTGAACAGTCCGTTAACACCTTCATC
 
. : . : . : . : . : . :
rJMSF007N10+ TCCCGTTCCTGGACTCTTTCAACAGCTCAGAATTCCATTCCTTGGCGAATTTACTTGCCA
                      ____________________________________________________________
consensus TCCCGTTCCTGGACTCTTTCAACAGCTCAGAATTCCATTCCTTGGCGAATTTACTTGCCA
 
. : . : . : . : . : . :
rJMSF007N10+ GAATGCAGTAATGGCTGAGCGCTTCATCGAAGCAGGTAGCGCTTATGTCCTAAAACTGGA
                      ____________________________________________________________
consensus GAATGCAGTAATGGCTGAGCGCTTCATCGAAGCAGGTAGCGCTTATGTCCTAAAACTGGA
 
. : . : . : . : . : . :
rJMSF007N10+ GAAGGCTGATGTATACAGGTTACCATATTTGTCAAGCAGTGGTCCGGGTTTTGCTCTGCT
                      ____________________________________________________________
consensus GAAGGCTGATGTATACAGGTTACCATATTTGTCAAGCAGTGGTCCGGGTTTTGCTCTGCT
 
. : . : . : . : . : . :
JMSF011A03- AAAGGACATCCAGAGCCAGATATCATCTGGCTTTGC
rJMSF007N10+ TGATTCGGCAAAGAGAGCTAATTTCAAGGACATCCAGAGCCAGATATCATCTGGCTTTGC
rJMSF026L23+ AAAGGACATCCAGAGCCAGATATCATCTGGCTTTGC
rJMSF011A03+ AAAGGACATCCAGAGCCAGATATCATCTGGCTTTGC
JMSF026L23- AAAGGACATCCAGAGCCAGATATCATCTGGCTTTGC
                      ____________________________________________________________
consensus TGATTCGGCAAAGAGAGCTAATTTAAAGGACATCCAGAGCCAGATATCATCTGGCTTTGC
 
. : . : . : . : . : . :
JMSF011A03- CTCTGGAAGTTGGGATAAGCCAATTCTAGTGGCATGGGGAATATCAGATAAGTATCTTCC
rJMSF007N10+ CTCTGGAAGTTGGGATAAGCCAATTCTAGTGGCATGGGGAATATCAGATAAGTATCTTCC
rJMSF026L23+ CTCTGGAAGTTGGGATAAGCCAATTCTAGTGGCATGGGGAATATCAGATAAGTATCTTCC
rJMSF011A03+ CTCTGGAAGTTGGGATAAGCCAATTCTAGTGGCATGGGGAATATCAGATAAGTATCTTCC
JMSF026L23- CTCTGGAAGTTGGGATAAGCCAATTCTAGTGGCATGGGGAATATCAGATAAGTATCTTCC
                      ____________________________________________________________
consensus CTCTGGAAGTTGGGATAAGCCAATTCTAGTGGCATGGGGAATATCAGATAAGTATCTTCC
 
. : . : . : . : . : . :
JMSF011A03- ACAATCAGTGGCTGAAGAGTTTCAAAAGGGAAACCCTGACTCAGTTAAGCTTAAACTGAT
rJMSF007N10+ ACAATCAGTGGCTGAAGAGTTTCAAAAGGGAAACCCTGACTCAGTTAAGCTTAAACTGAT
rJMSF026L23+ ACAATCAGTGGCTGAAGAGTTTCAAAAGGGAAACCCTGACTCAGTTAAGCTTAAACTGAT
rJMSF011A03+ ACAATCAGTGGCTGAAGAGTTTCAAAAGGGAAACCCTGACTCAGTTAAGCTTAAACTGAT
JMSF026L23- ACAATCAGTGGCTGAAGAGTTTCAAAAGGGAAACCCTGACTCAGTTAAGCTTAAACTGAT
                      ____________________________________________________________
consensus ACAATCAGTGGCTGAAGAGTTTCAAAAGGGAAACCCTGACTCAGTTAAGCTTAAACTGAT
 
. : . : . : . : . : . :
JMSF011A03- TGAAGGTGCAGGCCACATGCCGCAAGAAGACTGGCCCGAAAAAGTAGTTGATGCCTTGAG
rJMSF007N10+ TGAAGGTGCAGGCCACATGCCGCAAGAAGACTGGCCCGAAAAAGTAGTTGGTGCCTTGAG
rJMSF026L23+ TGAAGGTGCAGGCCACATGCCGCAAGAAGACTGGCCCGAAAAAGTAGTTGATGCCTTGAG
rJMSF011A03+ TGAAGGTGCAGGCCACATGCCGCAAGAAGACTGGCCCGAAAAAGTAGTTGATGCCTTGAG
JMSF026L23- TGAAGGTGCAGGCCACATGCCGCAAGAAGACTGGCCCGAAAAAGTAGTTGATGCCTTGAG
                      ____________________________________________________________
consensus TGAAGGTGCAGGCCACATGCCGCAAGAAGACTGGCCCGAAAAAGTAGTTGATGCCTTGAG
 
. : . : . : . : . : . :
JMSF011A03- AGTCTTTTTATGATCTTGGCATATGGTTTCCCAGCATGAATTCTCATACC
rJMSF007N10+ AGTCTTTTTATGATCTTGGCATATGGTTTCCCAGCATGAATTCTCATACCAATTTCAAGT
rJMSF026L23+ AGTCTTTTTATGATCTTGGCATATGGTTTCCCAGCATGAATTCTCATACCAATTTCAAGT
rJMSF011A03+ AGTCTTTTTATGATCTTGGCATATGGTTTCCCAGCATGAATTCTCATACCAATTTCAAGT
JMSF026L23- AGTCTTTTTATGATCTTGGCATATGGTTTCCCAGCATGAATTCTCATACCAATTTCAAGT
                      ____________________________________________________________
consensus AGTCTTTTTATGATCTTGGCATATGGTTTCCCAGCATGAATTCTCATACCAATTTCAAGT
 
. : . : . : . : . : . :
rJMSF007N10+ GTTTGTTCCATGTGAAGAATTATATATGCATTATTGGTAAGTTAAACATCACTGTTTGAT
rJMSF026L23+ GTTTGTTCCATGTGAAGAATTATATATGCATTATTGGTAAGTTAAACATCACTGTTTGAT
rJMSF011A03+ GTTTGTTCCATGTGAAGAATTATATATGCATTATTGGTAAGTTAAACATCACTGTTTGAT
JMSF026L23- GTTTGTTCCATGTGAAGAATTATATATGCATTATTGGTAAGTTAAACATCACTGTTTGAT
                      ____________________________________________________________
consensus GTTTGTTCCATGTGAAGAATTATATATGCATTATTGGTAAGTTAAACATCACTGTTTGAT
 
. : . : . : . : . : . :
rJMSF007N10+ AAAATACATACTCAGCTTGTACATCCTTACCAGAAAAAATCTCAGTTTCATGTGAGTATT
rJMSF026L23+ AAAATACATACTCAGCTTGTACATCCTTACCAGAAAAAATCTCAGTTTCATGTGAGTATT
rJMSF011A03+ AAAATACATACTCAGCTTGTACATCCTTACCAGAAAAAATCTCAGTTTCATGTGAGTATT
JMSF026L23- AAAATACATACTCAGCTTGTACATCCTTACCAGAAAAAATCTCAGTTTCATGTGAGTATT
                      ____________________________________________________________
consensus AAAATACATACTCAGCTTGTACATCCTTACCAGAAAAAATCTCAGTTTCATGTGAGTATT
 
. : . : . : . : . : . :
rJMSF007N10+ GTAAAATATTGCCAACTACTGCAGAAATGTTAGTTTCTAGTTTCAACAGAATGCAGAAAG
rJMSF026L23+ GTAAAATATTGCCAACTACTGCAGAAATGTTAGTTTCTAGTTTCAACAGAATGCAGAAAG
rJMSF011A03+ GTAAAATATTGCCAACTACTGCAGAAATGTTAGTTTCTAGTTTCAACAGAATGCAGAAAG
JMSF026L23- GTAAAATATTGCCAACTACTGCAGAAATGTTAGTTTCTAGTTTCAACAGAATGCAGAAAG
                      ____________________________________________________________
consensus GTAAAATATTGCCAACTACTGCAGAAATGTTAGTTTCTAGTTTCAACAGAATGCAGAAAG
 
. : . : . : . : . : . :
rJMSF007N10+ TTTTGGCCTTTATGTCCCTAAACATGCTGAGATATGCAAGTTATTT
rJMSF026L23+ TTTTGGCCTT
rJMSF011A03+ TTTTGGCCTT
JMSF026L23- TTTTGGCCTTTATGTGCCTAAACATGCTGAGATATGCAAGTTATTTTAACAAANAAAAAA
                      ____________________________________________________________
consensus TTTTGGCCTTTATGTGCCTAAACATGCTGAGATATGCAAGTTATTTTAACAAANAAAAAA