Previous Contig 006401:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026L13Sequence690006401 (2)gb:ATAC009177_15428488e-08Arabidopsis thaliana chromosome III BAC T12H1 genomic sequence, complete sequenc729012492 (3)gb:AP004274_18396044e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P045
JMSF039C19Sequence720006401 (2)gb:ATAC009177_15428489e-08Arabidopsis thaliana chromosome III BAC T12H1 genomic sequence, complete sequenc800012492 (3)gb:AP004274_18396043e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P045

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039C19+ CTGAGAGAAAANTTAGAATTCTCCTATAATAAGGAAGCCACCAATACAATGATCTAGATG
JMSF026L13+ AAGGAAGCCACCAATACAATGATCTAGATG
                      ____________________________________________________________
consensus CTGAGAGAAAANTTAGAATTCTCCTATAATAAGGAAGCCACCAATACAATGATCTAGATG
 
. : . : . : . : . : . :
JMSF039C19+ AACTTACTGACCTATTAGCATATACTTAAGCATTTATAACTTGTTAATTAGCCACCAGAT
JMSF026L13+ AACTTACTGACCTATTAGCATATACTTAAGCATTTATAACTTGTTAATTAGCCACCAGAT
                      ____________________________________________________________
consensus AACTTACTGACCTATTAGCATATACTTAAGCATTTATAACTTGTTAATTAGCCACCAGAT
 
. : . : . : . : . : . :
JMSF039C19+ ATTCCCTAATTGATTCATTTACATAAAAATTAAAAGGCACTCTAAAATACTTCCTGTTTG
JMSF026L13+ ATTCCCTAATTGATTCATTTACATAAAAATTAAAAGGCACTCTAAAATACTTCCTGTTTG
                      ____________________________________________________________
consensus ATTCCCTAATTGATTCATTTACATAAAAATTAAAAGGCACTCTAAAATACTTCCTGTTTG
 
. : . : . : . : . : . :
JMSF039C19+ TGTGGCGTTAAAGATACTTACATATATGATGCTCAACAGTTCCGTAAATGATAAAATAGC
JMSF026L13+ TGTGGCGTTAAAGATACTTACATATATGATGCTCAACAGTTCCGTAAATGATAAAATAGC
                      ____________________________________________________________
consensus TGTGGCGTTAAAGATACTTACATATATGATGCTCAACAGTTCCGTAAATGATAAAATAGC
 
. : . : . : . : . : . :
JMSF039C19+ ACTTCATCTTTCAACAAAAATTATTCACTTTGCGAATAAGAAGATCAAACCTAACCAAAT
JMSF026L13+ ACTTCATCTTTCAACAAAAATTATTCACTTTGCGAATAAGAAGATCAAACCTAACCAAAT
                      ____________________________________________________________
consensus ACTTCATCTTTCAACAAAAATTATTCACTTTGCGAATAAGAAGATCAAACCTAACCAAAT
 
. : . : . : . : . : . :
JMSF039C19+ TATAACCTCACTCGTGTACTCAAATAAGCATAATATACGGACAGAAGGTTAAAGGGGCAT
JMSF026L13+ TATAACCTCACTCGTGTACTCAAATAAGCATAATATACGGACAGAAGGTTAAAGGGGCAT
                      ____________________________________________________________
consensus TATAACCTCACTCGTGTACTCAAATAAGCATAATATACGGACAGAAGGTTAAAGGGGCAT
 
. : . : . : . : . : . :
JMSF039C19+ ACTGAAGCAGATCCTGGAGCTGTTGTTGGCGTGTACGAGGGTTAATCCCTTTTCGGAGCA
JMSF026L13+ ACTGAAGCAGATCCTGGAGCTGTTGTTGGCGTGTACGAGGGTTAATCCCTTTTCGGAGTA
                      ____________________________________________________________
consensus ACTGAAGCAGATCCTGGAGCTGTTGTTGGCGTGTACGAGGGTTAATCCCTTTTCGGAGTA
 
. : . : . : . : . : . :
JMSF039C19+ CATTTTCTTTCATATGGAGCCCATTGGCCTCGATCTGCTCCCTCGCCCACTCAACATCCT
JMSF026L13+ CATTTTCTTTCATATGGAGCCCATTGGCCTCGATCTGCTCCCTCGCCCACTCAACATCCT
                      ____________________________________________________________
consensus CATTTTCTTTCATATGGAGCCCATTGGCCTCGATCTGCTCCCTCGCCCACTCAACATCCT
 
. : . : . : . : . : . :
JMSF039C19+ CCGCCGACGCCGAGATCCGCTCCCCCGGTCTGACAGCGCTAGAGGCGGCAGTGCGGTCAG
JMSF026L13+ CCGCCGACGCCGAGATCCGCTCCCCCGGTCTGACAGCGCTAGAGGCGGCAGTGCGGTCAG
                      ____________________________________________________________
consensus CCGCCGACGCCGAGATCCGCTCCCCCGGTCTGACAGCGCTAGAGGCGGCAGTGCGGTCAG
 
. : . : . : . : . : . :
JMSF039C19+ GCGCGGAAGGGCAAGAGCAATTCGAGGTAGATGAAGGTGAAGAAAGGGAGGAGAGGAGCA
JMSF026L13+ GCGCGGAAGGGCAAGAGCAATTCGAGGTAGATGAAGGTGAAGAAAGGGAGGAGAGGAGCA
                      ____________________________________________________________
consensus GCGCGGAAGGGCAAGAGCAATTCGAGGTAGATGAAGGTGAAGAAAGGGAGGAGAGGAGCA
 
. : . : . : . : . : . :
JMSF039C19+ AGAAGAAGAAGACGGCGGCTGCCGCGGCGGAGAGAACAAGCACCGGCACTGATATCACCA
JMSF026L13+ AGAAGAAGAAGACGGCGGCTGCCGCGGCGGAGAGAACAAGCACCGGCACTGATATCACCA
                      ____________________________________________________________
consensus AGAAGAAGAAGACGGCGGCTGCCGCGGCGGAGAGAACAAGCACCGGCACTGATATCACCA
 
. : . : . : . : . : . :
JMSF039C19+ CTCTCTTGGATGATGCCAGCAGAGCCATAGTCCATAGACCATAGTAGTGCTGATGATC
JMSF026L13+ CTCTCTTGGATGATGCCAGCAGAGCCATAGTCCATAGACCATAGTAGTGCTGATGATCCC
                      ____________________________________________________________
consensus CTCTCTTGGATGATGCCAGCAGAGCCATAGTCCATAGACCATAGTAGTGCTGATGATCCC