Previous Contig 006398:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009G10Sequence561006398 (9)pir|B84833|B848332e-58hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153
JMFF018F01Sequence587006398 (9)pir|B84833|B848332e-62hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153682011784 (6)gb:AP003446_18295343e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15
JMFF034P21Sequence502006398 (9)pir|B84833|B848332e-49hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153
JMFS045B06Sequence594006398 (9)pir|B84833|B848331e-60hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153
JMFS067D05Sequence613006398 (9)pir|B84833|B848332e-80hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153
JMFS082G08Sequence616006398 (9)pir|B84833|B848333e-85hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153
JMSF014F15Sequence480006398 (9)pir|B84833|B848332e-48hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153787011784 (6)gb:AP003446_18295345e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15
JMSF026K23Sequence648006398 (9)pir|B84833|B848331e-72hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153735011784 (6)gb:AP003446_18295342e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15
JMSF027I22Sequence688006398 (9)pir|B84833|B848332e-90hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153713011784 (6)gb:AP003446_18295342e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027I22+ AGCCATTCATATTGCAGCATTGGTCCA
                      ____________________________________________________________
consensus AGCCATTCATATTGCAGCATTGGTCCA
 
. : . : . : . : . : . :
JMFS082G08+ AAGTTTCATTGTTTCCATCAAACTCAGAAAGAACATCCAAGGCATGCAATTTCCAA
JMFS067D05+ GAAAGAACATCCAAGGCATGCAATTTCCAA
JMSF027I22+ GTAGAAGTTTCATTGTTTCCATCAAACTCAGAAAGAACATCCAAGGCATGCAATTTCCAA
                      ____________________________________________________________
consensus GTAGAAGTTTCATTGTTTCCATCAAACTCAGAAAGAACATCCAAGGCATGCAATTTCCAA
 
. : . : . : . : . : . :
JMFS082G08+ TCTAGAGTTTGAGTAACAACAACACTAGCAACACAAACATTGCCATGAACAAGTTTACAA
JMFS067D05+ TCTAGAGTNTGAGTAACAACAACACTAGCAACACAAACATTGCCATGAACAAGTTTACAA
JMSF027I22+ TCTAGAGTTTGAGTAACAACAACACTAGCAACACAAACATTGCCATGAACAAGTTTACAA
JMFS045B06+ CAA
JMSF026K23+ GTAACAACAACACTAGCAACACAAACATTGCCATGAACAAGTTTACAA
                      ____________________________________________________________
consensus TCTAGAGTTTGAGTAACAACAACACTAGCAACACAAACATTGCCATGAACAAGTTTACAA
 
. : . : . : . : . : . :
JMFS082G08+ TCATTATTCAAGAAGCTCACAGCCTTGGTTATCCGATGCAGTCCCCAGGCATAATATTCA
JMFS067D05+ TCATTATTCAAGAAGCTCACAGCCTTGGTTATCCGATGCAGTCCCCAGGCATAATATTCA
JMSF027I22+ TCATTATTCAAGAAGCTCACAGCCTTGGTTATCCGATGCAGTCCCCAGGCATAATATTCA
JMFF018F01+ ATTCAAGAAGCTCACAGCCTTGGTTATCCGATGCAGTCCCCAGGCATAATATTCA
JMFS045B06+ TCATTATTCAAGAAGCTCACAGCCTTGGTTATCCGATGCAGTCCCCAGGCATAATATTCA
JMFF009G10+ TCCGATGCAGTCCCCAGGCATAATATTCA
JMSF026K23+ TCATTATTCAAGAAGCTCACAGCCTTGGTTATCCGATGCAGTCCCCAGGCATAATATTCA
                      ____________________________________________________________
consensus TCATTATTCAAGAAGCTCACAGCCTTGGTTATCCGATGCAGTCCCCAGGCATAATATTCA
 
. : . : . : . : . : . :
JMFS082G08+ TCTCTTTGTGTGCCCACTAATCCTAATTCCTTGAGCTTTTCACAAAGTGGCATTACAGGC
JMFS067D05+ TCTCTTTGTGTGCCCACTAATCCTAATTCCTTGAGCTTTTCACAAAGTGGCATTACAGGC
JMSF027I22+ TCTCTTTGTGTGCCCACTAATCCTAATTCCTTGAGCTTTTCACAAAGTGGCATTACAGGC
JMFF018F01+ TCTCTTTGTGTGCCCACTAATCCTAATTCCTTGAGCTTTTCACAAAGTGGCATTACAGGC
JMFS045B06+ TCTCTTTGTGTGCCCACTAATCCTAATTCCTTGAGCTTTTCACAAAGTGGCATTACAGGC
JMFF034P21+ TTGAGCTTTTCACAAAGTGGCATTACAGGC
JMSF014F15+ CACAAAGTGGCATTACAGGC
JMFF009G10+ TCTCTTTGTGTGCCCACTAATCCTAATTCCTTGAGCTTTTCACAAAGTGGCATTACAGGC
JMSF026K23+ TCTCTTTGTGTGCCCACTAATCCTAATTCCTTGAGCTTTTCACAAAGTGGCATTACAGGC
                      ____________________________________________________________
consensus TCTCTTTGTGTGCCCACTAATCCTAATTCCTTGAGCTTTTCACAAAGTGGCATTACAGGC
 
. : . : . : . : . : . :
JMFS082G08+ TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
JMFS067D05+ TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
JMSF027I22+ TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
JMFF018F01+ TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
JMFS045B06+ TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
JMFF034P21+ TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
JMSF014F15+ TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
JMFF009G10+ TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
JMSF026K23+ TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
                      ____________________________________________________________
consensus TCAGTGACAATATAAATAGTAACCTTTGTTGTAGAACCATCAACAGTTTCAACTTCCGTG
 
. : . : . : . : . : . :
JMFS082G08+ CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
JMFS067D05+ CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
JMSF027I22+ CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
JMFF018F01+ CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
JMFS045B06+ CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
JMFF034P21+ CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
JMSF014F15+ CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
JMFF009G10+ CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
JMSF026K23+ CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
                      ____________________________________________________________
consensus CTGTGAAGAAATGATAAAATATTGGGATGCCTGACTGTGCGAAGTCGTTTAACTCCATTG
 
. : . : . : . : . : . :
JMFS082G08+ CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
JMFS067D05+ CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
JMSF027I22+ CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
JMFF018F01+ CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
JMFS045B06+ CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
JMFF034P21+ CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
JMSF014F15+ CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
JMFF009G10+ CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
JMSF026K23+ CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
                      ____________________________________________________________
consensus CGACCAGCTGCCAAATGCCCATCATTTGCGTTACTACCTGAGAGTGCGAATATAGACACA
 
. : . : . : . : . : . :
JMFS082G08+ GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGAGCCCCAAGCAGAGGAA
JMFS067D05+ GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGAGCCCCAAGCAGAGGAA
JMSF027I22+ GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGAGCCCCAAGCAGAGGAA
JMFF018F01+ GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGATCCCCAAGCAGAGGAA
JMFS045B06+ GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGAGCCCCAAGCAGAGGAA
JMFF034P21+ GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGAGCCCCAAGCAGAGGAA
JMSF014F15+ GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGAGCCCCAAGCAGAGGAA
JMFF009G10+ GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGAGCCCCAAGCAGAGGAA
JMSF026K23+ GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGAGCCCCAAGCAGAGGAA
                      ____________________________________________________________
consensus GGAGCACCATCGTCTTTGGAGGTTCCACGGTAGTGAACCCAAGAGCCCCAAGCAGAGGAA
 
. : . : . : . : . : . :
JMFS082G08+ TAAGGCTCGCCGATGTTGTATGGCAGATCCTTGACGCCCGCCCCAGATCCGGCGACGACG
JMFS067D05+ TAAGGCTCGCCGATGTTGTATGGCAGATCCTTGACGCCCGCCCCAGATCCGGCGACGACG
JMSF027I22+ TAAGGCTCGCCGATGTTGTATGGCAGATCCTTGACGCCCGCCCCAGATCCGGCGACGACG
JMFF018F01+ TAAGGCTCGCCGATGTTGTATGGCAGATCCTTGACGCCCGCCCCAGATCCGGCGACGACG
JMFS045B06+ TAAGGCTNGCNGANGNTGTAAGGCAGATCCNTGACGCCCGCCCCAGATCCGGCGACGACG
JMFF034P21+ TAAGGCTCGCCGATGTTGTATGGCAGATCCTTGACGCCCGCCCCAGATCCGGCGACGACG
JMSF014F15+ TAAGGCTCGCCGATGTTGTATGGCAGATCCTTGACGCCCGCCCCAGATCCGGCGACGACG
JMFF009G10+ TAAGGCTCGCCGATGTTGTATGGCAGATCCTTGACGCCCGCCCCAGATCCGGCGACGACG
JMSF026K23+ TAAGGCTCGCCGATGTTGTATGGCAGATCCTTGACGCCCGCCCCAGATCCGGCGACGACG
                      ____________________________________________________________
consensus TAAGGCTCGCCGATGTTGTATGGCAGATCCTTGACGCCCGCCCCAGATCCGGCGACGACG
 
. : . : . : . : . : . :
JMFS082G08+ CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
JMFS067D05+ CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
JMSF027I22+ CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
JMFF018F01+ CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
JMFS045B06+ CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
JMFF034P21+ CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
JMSF014F15+ CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
JMFF009G10+ CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
JMSF026K23+ CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
                      ____________________________________________________________
consensus CCTTTCAAGAATTTCAGCATCGTTTATCTTCCGGTAATACGCCACCCGCCGTTTACCGGC
 
. : . : . : . : . : . :
JMFS082G08+ GACGATCGATCTGGAGATTT
JMFS067D05+ GACGATCGATCTGGAGATTTGGTGCCGGGGGAAGGGAAGGAGG
JMSF027I22+ GACGATCGATCTGGAGATTTGGTGCCGGGGGAAGGGAAGGAGGGGTGGAAAGACGAGTAT
JMFF018F01+ GACGATCGATCTGGAGATTTGGTGCCGGGGGAAGGGAAGGAGGGGTGGAAAGACGAGTAT
JMFS045B06+ GACGATCGATCTGGAGATTTGGTGCCGGGGGAAGGGAAGGAGGGGTGGAAAGACGAGTAT
JMFF034P21+ GACGATCGATCTGGAGATTTGGTGCCGGGGGAAGGGAAGGAGGGGTGGAAAGACGAGTAT
JMSF014F15+ GACGATCGATCTGGAGATTTGGTGCCGGGGGAAGGGAAGGAGGGGTGGAAAGACGAGTAT
JMFF009G10+ GACGATCGATCTGGAGATTTGGTGCCGGGGGAAGGGAAGGAGGGGTGGAAAGACGAGTAT
JMSF026K23+ GACGATCGATCTGGAGATTTGGTGCCGGGGGAAGGGAAGGAGGGGTGGAAAGACGAGTAT
                      ____________________________________________________________
consensus GACGATCGATCTGGAGATTTGGTGCCGGGGGAAGGGAAGGAGGGGTGGAAAGACGAGTAT
 
. : . : . : . : . : . :
JMFF018F01+ GCGAAACGAAGTGCGGAAGATCGGAAAATATTTGCTCGATTCAGTACTTGGC
JMFS045B06+ GCGAAACGAAGTGCGGAAGATCGGAAAATATTTGCTCGATTCAGTACTTGG
JMFF034P21+ GCGAAACGAAGTGCGGAAGATCGGAAAATATTTGCTCGATTCAGTACTTGGC
JMSF014F15+ GCGAAACGAAGTGCGGAAGATCGGAAAATATTTGCTC
JMFF009G10+ GCGAAACGAAGTGCGGAAGATCGGAAAATATTTGCTCGATTCAGTACTTGGC
JMSF026K23+ GCGAAACGAAGTGCGGAAGATCGGAAAATATTTGCTCGATTCAGTACTTGGCGATCGACC
                      ____________________________________________________________
consensus GCGAAACGAAGTGCGGAAGATCGGAAAATATTTGCTCGATTCAGTACTTGGCGATCGACC