Previous Contig 006395:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026K12Sequence663006395 (2)gb:AY714244_16240161e-61Pisum sativum MtN19-like protein mRNA, complete cds.674012486 (3)gb:AY714244_16240161e-26Pisum sativum MtN19-like protein mRNA, complete cds.
JMSF035F05Sequence628006395 (2)gb:AY714244_16240163e-54Pisum sativum MtN19-like protein mRNA, complete cds.773012486 (3)gb:AY714244_16240164e-47Pisum sativum MtN19-like protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026K12+ ACAGATTG
                      ____________________________________________________________
consensus ACAGATTG
 
. : . : . : . : . : . :
JMSF035F05+ TACTCCTCGTGTATCAATTGCATGCACA
JMSF026K12+ CACCGGCACTCAGTACATCCCAACCTATCTTCTACTCCTCGTGTATCAATTGCATGCACA
                      ____________________________________________________________
consensus CACCGGCACTCAGTACATCCCAACCTATCTTCTACTCCTCGTGTATCAATTGCATGCACA
 
. : . : . : . : . : . :
JMSF035F05+ TTAAGCATCCATTTCTCCTCGTAGCCCTGCGGGATATCTGCTGGATTGCCAGCTTCAATT
JMSF026K12+ TTAAGCATCCATTTCTCCTCGTAGCCCTGCGGGATATCTGCTGGATTGCCAGCTTCAATT
                      ____________________________________________________________
consensus TTAAGCATCCATTTCTCCTCGTAGCCCTGCGGGATATCTGCTGGATTGCCAGCTTCAATT
 
. : . : . : . : . : . :
JMSF035F05+ CCATAAGGATCTGGAACGTGAGTGTCAGTCTTCCTCGTCTCCGATCCAAGCCCAAAATAT
JMSF026K12+ CCATAAGGATCTGGAACGTGAGTGTCAGTCTTCCTCGTCTCCGATCCAAGCCCAAAATAT
                      ____________________________________________________________
consensus CCATAAGGATCTGGAACGTGAGTGTCAGTCTTCCTCGTCTCCGATCCAAGCCCAAAATAT
 
. : . : . : . : . : . :
JMSF035F05+ TGTGTAAGGGTACTGCCACAAACCCCAGAGTTCCTTGCAGAAATATAATCCGGTTCTTGG
JMSF026K12+ TGTGTAAGGGTACTGCCACAAACCCCAGAGTTCCTTGCAGAAATATAATCCGGTTCTTGG
                      ____________________________________________________________
consensus TGTGTAAGGGTACTGCCACAAACCCCAGAGTTCCTTGCAGAAATATAATCCGGTTCTTGG
 
. : . : . : . : . : . :
JMSF035F05+ AACCCCATATTGGGGTGATAATTTGGAGCTTTAACACCTTGACGTATAAAGTATCTTACA
JMSF026K12+ AACCCCATATTGGGGTGATAATTTGGAGCTTTAACACCTTGACGTATAAAGTATCTTACA
                      ____________________________________________________________
consensus AACCCCATATTGGGGTGATAATTTGGAGCTTTAACACCTTGACGTATAAAGTATCTTACA
 
. : . : . : . : . : . :
JMSF035F05+ ACAAGCCAGTGGTGTAGATATGTTTCGTGAAGTGGGATCGAGTTTCCTGCCTCATCAACC
JMSF026K12+ ACAAGCCAGTGGTGTAGATATGTTTCGTGAAGTGGGATCGAGTTTCCTGCCTCATCAACC
                      ____________________________________________________________
consensus ACAAGCCAGTGGTGTAGATATGTTTCGTGAAGTGGGATCGAGTTTCCTGCCTCATCAACC
 
. : . : . : . : . : . :
JMSF035F05+ ACTTCTGCAACAAACTCTTTTATAGCAATGTGGCCTCTTGGAAAGTCGATATCGTAATAG
JMSF026K12+ ACTTCTGCAACAAACTCTTTTATAGCAATGTGGCCTCTTGGAAAGTCGATATCGTAATAG
                      ____________________________________________________________
consensus ACTTCTGCAACAAACTCTTTTATAGCAATGTGGCCTCTTGGAAAGTCGATATCGTAATAG
 
. : . : . : . : . : . :
JMSF035F05+ AACTTGTTAGAGACTGATCCAGGTTCCAACTCAAACTTGGGGGATAGGAAAACTTCAGTT
JMSF026K12+ AACTTGTTAGAGACTGATCCAGGTTCCAACTCAAACTTGGGGGATAGGAAAACTTCAGTT
                      ____________________________________________________________
consensus AACTTGTTAGAGACTGATCCAGGTTCCAACTCAAACTTGGGGGATAGGAAAACTTCAGTT
 
. : . : . : . : . : . :
JMSF035F05+ TTTACCCCATCCTGAGTTTGTATAGTTTGAGAAACTGTAGTCAATATTAGGATTGCCACT
JMSF026K12+ TTTACCCCATCCTGAGTTTGTATAGTTTGAGAAACTGTAGTCAATATTAGGATTGCCACT
                      ____________________________________________________________
consensus TTTACCCCATCCTGAGTTTGTATAGTTTGAGAAACTGTAGTCAATATTAGGATTGCCACT
 
. : . : . : . : . : . :
JMSF035F05+ GATAGCAACCACCAATCAGACCTGTGTGACATATCTTTTTTCTCCTTTTTACTCTTTTCT
JMSF026K12+ GATAGCAACCACCAATCAGACCTGTGTGACATATCTTTTTTCTCCTTTTTACTCTTTT--
                      ____________________________________________________________
consensus GATAGCAACCACCAATCAGACCTGTGTGACATATCTTTTTTCTCCTTTTTACTCTTTTCT
 
. : . : . : . : . : . :
JMSF035F05+ TACATTTCTTGGATATTGGGATGAGGAAACTCCTTGTAATGATTGAGATAGTGAAAATCC
JMSF026K12+ ---ATTTCTTGGATATTGGGATGAGGAAACTCCTTGTAATGATTGAGATAGTGAAAATCC
                      ____________________________________________________________
consensus TACATTTCTTGGATATTGGGATGAGGAAACTCCTTGTAATGATTGAGATAGTGAAAATCC