Previous Contig 006391:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010I03Sequence242006391 (4)gb:AY693650_16234482e-05Ocimum basilicum terpinolene synthase (TES) mRNA, complete cds.687022378gb:QIL304839_17031972e-05Quercus ilex mRNA for putative chloroplast terpene synthase (16 gene).
JMSF023B22Sequence612006391 (4)gb:AF444798_18004103e-30Perilla frutescens var. crispa cultivar No. 79 linalool synthase mRNA, complete
JMSF026J17Sequence573006391 (4)gb:AF444798_18004102e-23Perilla frutescens var. crispa cultivar No. 79 linalool synthase mRNA, complete 748023234gb:AY572987_16157552e-66Vitis vinifera clone VitiC4568 terpenoid synthase mRNA, complete cds.
JMSF040M15Sequence569006391 (4)gb:AF444798_18004108e-23Perilla frutescens var. crispa cultivar No. 79 linalool synthase mRNA, complete 877023917gb:QIL304839_17031971e-74Quercus ilex mRNA for putative chloroplast terpene synthase (16 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023B22+ TGACAGAAAAGATGCTT
                      ____________________________________________________________
consensus TGACAGAAAAGATGCTT
 
. : . : . : . : . : . :
JMSF040M15+ CTTGGCCAAGGTTGACATTAAATCTAGACCGTC
JMSF023B22+ CATATAAGTTCAGTAATCCCTTAATATCTTGGCCAAGGTTGACATTAAATCTAGACCGTC
JMSF026J17+ CTTGGCCAAGGTTGACATTAAATCTAGACCGTC
                      ____________________________________________________________
consensus CATATAAGTTCAGTAATCCCTTAATATCTTGGCCAAGGTTGACATTAAATCTAGACCGTC
 
. : . : . : . : . : . :
JMSF040M15+ TTCCATCCATGAAACAATCAAATACCTCTTGAGAGATGTTGAAGCCATTTTGTCTGAGCA
JMSF023B22+ TTCCATCCATGAAACAATCAAATACCTCTTGAGAGATGTTGAAGCCATTTTGTCTGAGCA
JMSF026J17+ TTCCATCCATGAAACAATCAAATACCTCTTGAGAGATGTTGAAGCCATTTTGTCTGAGCA
                      ____________________________________________________________
consensus TTCCATCCATGAAACAATCAAATACCTCTTGAGAGATGTTGAAGCCATTTTGTCTGAGCA
 
. : . : . : . : . : . :
JMSF040M15+ CTCTAAACTCAAGAGCTGTGGCATACCAGTCCTTCTCTTCTGATGACTTGTAATTGTTAC
JMSF023B22+ CTCTAAACTCAAGAGCTGTGGCATACAAGTCCTTCTCTTCTGATGACTTGTAATTGTTAC
JMSF026J17+ CTCTAAACTCAAGAGCTGTGGCATACAAGTCCTTCTCTTCTGATGACTTGTAATTGTTAC
                      ____________________________________________________________
consensus CTCTAAACTCAAGAGCTGTGGCATACAAGTCCTTCTCTTCTGATGACTTGTAATTGTTAC
 
. : . : . : . : . : . :
JMSF040M15+ TACTCTTCTTCTTCTTCTTCATATAGATATCCATCAAAGCTGCCATGATTTCTTCCTCAA
JMSF023B22+ TACTCTTCTTCTTCTTCTTCATATAGATATCCATCAAAGCTGCCATGATTTCTTCCTCAA
JMSF026J17+ TACTCTTCTTCTTCTTCTTCATATAGATATCCATCAAAGCTGCCATGATTTCTTCCTCAA
                      ____________________________________________________________
consensus TACTCTTCTTCTTCTTCTTCATATAGATATCCATCAAAGCTGCCATGATTTCTTCCTCAA
 
. : . : . : . : . : . :
JMSF040M15+ AATGGTAAGAACAACCAAGCCTCTGCAGTTCATCAATCATCTCCATTTTCTCCACTTCTT
JMSF023B22+ AATGGTAAGAACAACCAAGCCTCTGCAGTTCATCAATCATCTCCATTTTCTCCACTTCCT
JMSF026J17+ AATGGTAAGAACAACCAAGCCTCTGCAGTTCATCAATCATCTCCATTTTCTCCACTTCTT
                      ____________________________________________________________
consensus AATGGTAAGAACAACCAAGCCTCTGCAGTTCATCAATCATCTCCATTTTCTCCACTTCTT
 
. : . : . : . : . : . :
JMSF040M15+ TCATCTCTTCATTCTTCAGCATATCCTTCACTCTCTCCTTCAACTCGTCGCGTCGCATAA
JMSF023B22+ TCATCTCTTCATTCTTCAGCATATCCTTCACTCTCTCCTTCAACTCGTCGCGTCGCATAA
JMSF010I03+ CGCATAA
JMSF026J17+ TCATCTCTTCATTCTTCAGCATATCCTTCACTCTCTCCTTCAACTCGTCGCGTCGCATAA
                      ____________________________________________________________
consensus TCATCTCTTCATTCTTCAGCATATCCTTCACTCTCTCCTTCAACTCGTCGCGTCGCATAA
 
. : . : . : . : . : . :
JMSF040M15+ CAAAGCCCTCAGCAGTATAATGAGTGGTGTTGAGTGATTGAATGTAAGAGTAATCCCAGG
JMSF023B22+ CAAAGCCCTCAGCAGTATAATGAGTGGTGTTGAGTGATTGAATGTAAGAGTAATCCCAGG
JMSF010I03+ CAAAGCCCTCAGCAGTATAATGAGTGGTGTTGAGTGATTGAATGTAAGAGTAATCCCAGG
JMSF026J17+ CAAAGCCCTCAGCAGTATAATGAGTGGTGTTGAGTGATTGAATGTAAGAGTAATCCCAGG
                      ____________________________________________________________
consensus CAAAGCCCTCAGCAGTATAATGAGTGGTGTTGAGTGATTGAATGTAAGAGTAATCCCAGG
 
. : . : . : . : . : . :
JMSF040M15+ TGGGAGGCTCATAATTGCCAGATCTTCTTGTAGTAGTTGTGGTGTGATAACACATGCTAA
JMSF023B22+ TGGGAGGCTCATAATTGCCAGATCTTCTTGTAGTAGTTGTGGTGTGATAACACATGCTAA
JMSF010I03+ TGGGAGGCTCATAATTGCCAGATCTTCTTGTAGTAGTTGTGGTGTGATAACACATGCTAA
JMSF026J17+ TGGGAGGCTCATAATTGCCAGATCTTCTTGTAGTAGTTGTGGTGTGATAACACATGCTAA
                      ____________________________________________________________
consensus TGGGAGGCTCATAATTGCCAGATCTTCTTGTAGTAGTTGTGGTGTGATAACACATGCTAA
 
. : . : . : . : . : . :
JMSF040M15+ ATGAAGATTCTGCATGAGATCTATGAATAGATGGCAGGCAAGAAAGTTTGTATGTGAAAG
JMSF023B22+ ATGAAGATTCTGCATGAGATCTATGAATAGATGGCAGGCAAGAAAGTTTGTATGTGAAAG
JMSF010I03+ ATGAAGATTCTGCATGAGATCTATGAATAGATGGCAGGCAAGAAAGTTTGTATGTGAAAG
JMSF026J17+ ATGAAGATTCTGCATGAGATCTATGAATAGATGGCAGGCAAGAAAGTTTGTATGTGAAAG
                      ____________________________________________________________
consensus ATGAAGATTCTGCATGAGATCTATGAATAGATGGCAGGCAAGAAAGTTTGTATGTGAAAG
 
. : . : . : . : . : . :
JMSF040M15+ TAGAGAGCACATTGAGGATTGCCATTTCCTTTTTCTCTATTTTTTAGTATTCCT
JMSF023B22+ TAGAGAGCACATTGAGGATTGCCATTTCCTTTTTCTCTATTTTTTAGTAATCCT
JMSF010I03+ TAGAGAGCACATTGAGGATTGCCATTTCCTTTTTCTCTATTTTTTAGTATTCCT
JMSF026J17+ TAGAGAGCACATTGAGGATTGCCATTTCCTTTTTCTCTATTTTTTAGTATTCCTGTTTTC
                      ____________________________________________________________
consensus TAGAGAGCACATTGAGGATTGCCATTTCCTTTTTCTCTATTTTTTAGTATTCCTGTTTTC