Previous Contig 006388:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS055H10Sequence642006388 (5)gb:AC098598_17367760.005Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1007_H05, complete s
JMFS068E07Sequence625006388 (5)gb:AC098598_17367760.003Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1007_H05, complete s
JMFS091F06Sequence496006388 (5)gb:AP005514_18532383e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMSF022D18Sequence650006388 (5)pir|T47959|T479597e-11hypothetical protein F15G16.60 - Arabidopsis thaliana>gb:ATF15G16_1548693 Arabid785012483 (2)pir|T47959|T479599e-59hypothetical protein F15G16.60 - Arabidopsis thaliana>gb:ATF15G16_1548693 Arabid
JMSF026J06Sequence334006388 (5)gb:AP005803_18580910.014Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN750012483 (2)pir|T47959|T479593e-63hypothetical protein F15G16.60 - Arabidopsis thaliana>gb:ATF15G16_1548693 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS068E07+ CATAGGGATCCTGATTAATAATCTTCCTATCGAGAGGGAACTTATCCTTTGGATTAT
JMFS055H10+ GATCCTGATTAATAATCTTCCTATCGAGAGGGAACTTATCCTTTGGATTAT
                      ____________________________________________________________
consensus CATAGGGATCCTGATTAATAATCTTCCTATCGAGAGGGAACTTATCCTTTGGATTAT
 
. : . : . : . : . : . :
JMFS068E07+ CAATCACTTCACAAGGTCGACTCAATTGCTCCTTCAGCTCATCCAACTTTCTCAAAAGCT
JMFS055H10+ CAATCACTTCACAAGGTCGACTCAATTGCTCCTTCAGCTCATCCAACTTTCTCAAAAGCT
                      ____________________________________________________________
consensus CAATCACTTCACAAGGTCGACTCAATTGCTCCTTCAGCTCATCCAACTTTCTCAAAAGCT
 
. : . : . : . : . : . :
JMFS068E07+ CAACTCTTTCATCTTCACTATACTCGGTTTTAGCAAACCCACTAGAAGAACTTTCCTCAC
JMFS055H10+ CAACTCTTTCATCTTCACTATACTCGGTTTTAGCAAACCCACTAGAAGAACTTTCCTCAC
                      ____________________________________________________________
consensus CAACTCTTTCATCTTCACTATACTCGGTTTTAGCAAACCCACTAGAAGAACTTTCCTCAC
 
. : . : . : . : . : . :
JMFS068E07+ TGTTCCCACTCCTCAGTGGCTGTTGATACCCGTAACTAGACCCCACCTGGTAACTGGATG
JMFS055H10+ TGTTCCCACTCCTCAGTGGCTGTTGATACCCGTAACTAGACCCCACCTGGTAACTGGATG
                      ____________________________________________________________
consensus TGTTCCCACTCCTCAGTGGCTGTTGATACCCGTAACTAGACCCCACCTGGTAACTGGATG
 
. : . : . : . : . : . :
JMFS068E07+ ATGAAGCATCTGCTGAATTATTCGAAACTGCATACATCGAACCGTCAATACCAATTCTTC
JMFS055H10+ ATGAAGCATCTGCTGAATTATTCGAAACTGCATACATCGAACCGTCAATACCAATTCTTC
                      ____________________________________________________________
consensus ATGAAGCATCTGCTGAATTATTCGAAACTGCATACATCGAACCGTCAATACCAATTCTTC
 
. : . : . : . : . : . :
JMFS068E07+ GGCCTCTCTGGGAAACCTCCGCTTTCCTTGCCTCCCCATTGCTTCTCCAATCTGGAATAC
JMFS055H10+ GGCCTCTCTGGGAAACCTCCGCTTTCCTTGCCTCCCCATTGCTTCTCCAATCTGGAATAC
                      ____________________________________________________________
consensus GGCCTCTCTGGGAAACCTCCGCTTTCCTTGCCTCCCCATTGCTTCTCCAATCTGGAATAC
 
. : . : . : . : . : . :
JMFS068E07+ GAACCGGTCTTTGCAAGCCCATTTCATTTGCATATTGGATGGTGGAATTCTGAAACTGTT
JMFS055H10+ GAACCGGTCTTTGCAAGCCCATTTCATTTGCATATTGGATGGTGGAATTCTGAAACTGTT
                      ____________________________________________________________
consensus GAACCGGTCTTTGCAAGCCCATTTCATTTGCATATTGGATGGTGGAATTCTGAAACTGTT
 
. : . : . : . : . : . :
JMFS068E07+ TCATAGTTCTTTCTTGACTTTGCTCATCACCCGTCTCATACATCTCCATATCATCAACTC
JMFS055H10+ TCATAGTTCTTTCTTGACTTTGCTCATCACCCGTCTCATACATCTCCATATCATCAACTC
JMSF022D18+ CAACTC
                      ____________________________________________________________
consensus TCATAGTTCTTTCTTGACTTTGCTCATCACCCGTCTCATACATCTCCATATCATCAACTC
 
. : . : . : . : . : . :
JMFS068E07+ TTGGGCGTCTATGAAAAGCCTCTGCTGCCTCGTTAGTCTCCCCACTTCTCCAATTCGGAA
JMFS055H10+ TTGGGCGTCTATGAAAAGCCTCTGCTGCCTCGTTAGTCTCCCCACTTCTCCAATTCGGAA
JMSF022D18+ TTGGGCGTCTATGAAAAGCNTCTGCTGCCTCGTTAGTCTCCCCACTTCTCCAATTCGGAA
                      ____________________________________________________________
consensus TTGGGCGTCTATGAAAAGCCTCTGCTGCCTCGTTAGTCTCCCCACTTCTCCAATTCGGAA
 
. : . : . : . : . : . :
JMFS068E07+ TTTCTTCCAGATTTGGCAACCCATTTTCACTTTCACATTCAGGAATGAACTTCTGAAGCT
JMFS055H10+ TTTCTTCCAGATTTGGCAACCCATTTTCACTTTCACATTCAGGAATGAACTTCTGAAGCT
JMSF022D18+ TTTCTTCCAGATTTGGCAACCCATTTTCACTTTCACATTCAGGAATGAACTTCTGAAGCT
                      ____________________________________________________________
consensus TTTCTTCCAGATTTGGCAACCCATTTTCACTTTCACATTCAGGAATGAACTTCTGAAGCT
 
. : . : . : . : . : . :
JMFS068E07+ GTTCCACGATTTTTTCTTGACTATGTTC
JMFS055H10+ GTTCCACGATTTTTTCTTGACTATGTTCATCTATAATCTCACACAATTCTG
JMFS091F06+ CGATTTTTTCTTGACTATGTTCATCTATAATCTCACACAATTCTGCATCATTAT
JMSF022D18+ GTTCCACGATTTTTTCTTGACTATGTTCATCTATAATCTCACACAATTCTGCATCATTAT
                      ____________________________________________________________
consensus GTTCCACGATTTTTTCTTGACTATGTTCATCTATAATCTCACACAATTCTGCATCATTAT
 
. : . : . : . : . : . :
JMFS091F06+ CATCCTCTAGCACCCATTTATCAGACTTACTTGTCAGATTAGACCTGTAATTTTCAACTC
JMSF022D18+ CATCCTCTAGCACCCATTTATCAGACTTACTTGTCAGATTAGACCTGTAATTTTCAACTC
                      ____________________________________________________________
consensus CATCCTCTAGCACCCATTTATCAGACTTACTTGTCAGATTAGACCTGTAATTTTCAACTC
 
. : . : . : . : . : . :
JMFS091F06+ TATCACCCAAAATCCCCCTCCTCTCATCTATGCTACAAGAACTACTAGCATTTGACTTCA
JMSF022D18+ TATCACCCAAAATCCCCCTCCTCTCATCTATGCTACAAGAACTACTAGCATTTGACTTCA
                      ____________________________________________________________
consensus TATCACCCAAAATCCCCCTCCTCTCATCTATGCTACAAGAACTACTAGCATTTGACTTCA
 
. : . : . : . : . : . :
JMFS091F06+ CATCATTCTCAGAACCATCACTCAAGTTCATCACTTTCTCAAATTTCTCAGAAACCCCTA
JMSF022D18+ CATCATTCTCAGAACCATCACTCAAGTTCATCACTTTCTCAAATTTCTCAGAAACCCCTA
                      ____________________________________________________________
consensus CATCATTCTCAGAACCATCACTCAAGTTCATCACTTTCTCAAATTTCTCAGAAACCCCTA
 
. : . : . : . : . : . :
JMFS091F06+ CTACCCTTTCTTCATCAGACTTGTCAGAAAATGTCACTACCTCTCCATTTTCATTCTTAG
JMSF022D18+ CTACCCTTTCTTCATCAGACTTGTCAGAAAATGTCTCCAACTCTCCATTTTCATTCTTAG
                      ____________________________________________________________
consensus CTACCCTTTCTTCATCAGACTTGTCAGAAAATGTCTCTACCTCTCCATTTTCATTCTTAG
 
. : . : . : . : . : . :
JMFS091F06+ CTCGTAAAACAGCACCACATCCACCACACTGGTAAACAGAGAAATCAGTGCCCTCCGGAA
JMSF022D18+ CTCGTAAAACAGCACCACATCCACCACACTGGTAAACAGAGAAATCAGTGACCTCCGGAA
JMSF026J06+ CACTGGTAAACAGAGAAATCAGTGACCTCCGGAA
                      ____________________________________________________________
consensus CTCGTAAAACAGCACCACATCCACCACACTGGTAAACAGAGAAATCAGTGACCTCCGGAA
 
. : . : . : . : . : . :
JMFS091F06+ GCAAATTTTCGCACTTGGGGCAACGAACAACGCGAACTTTTGGTGGCTCAGACATCTTCA
JMSF022D18+ GCAAATTTTCGCACTTGGGGCAACGAACAACGCGAACTTTTGGTGGCTCAGACATCTTCA
JMSF026J06+ GCAAATTTTCGCACTTGGGGCAACGAACAACGCGAACTTTTGGTGGCTCAGACATCTTCA
                      ____________________________________________________________
consensus GCAAATTTTCGCACTTGGGGCAACGAACAACGCGAACTTTTGGTGGCTCAGACATCTTCA
 
. : . : . : . : . : . :
JMFS091F06+ AAGAAGCTCAACCAAT
JMSF022D18+ AAGAAGCTCAACCAAT
JMSF026J06+ AAGAAGCTCANCCAATCTTGAAAACCAGTCATACAAAAACAAATTAATAAATAACTACCA
                      ____________________________________________________________
consensus AAGAAGCTCAACCAATCTTGAAAACCAGTCATACAAAAACAAATTAATAAATAACTACCA
 
. : . : . : . : . : . :
JMSF026J06+ CACCATATAATCAATTTACAAGTTTTTAAAATCTAAAATGGATATCTCAGACTGATGAGG
                      ____________________________________________________________
consensus CACCATATAATCAATTTACAAGTTTTTAAAATCTAAAATGGATATCTCAGACTGATGAGG
 
. : . : . : . : . : . :
JMSF026J06+ AGAGAGGGTGCAGAAACATCAANTGCGATATCCGTACATTCAATGAATACAATTNTTTTG
                      ____________________________________________________________
consensus AGAGAGGGTGCAGAAACATCAANTGCGATATCCGTACATTCAATGAATACAATTNTTTTG
 
. : . : . : . : . : . :
JMSF026J06+ TTTGTTTATGGATGACCGGAGCCCAGGCCCCAGAGGACGAAGACTCCGTGGGTCTTCTCC
                      ____________________________________________________________
consensus TTTGTTTATGGATGACCGGAGCCCAGGCCCCAGAGGACGAAGACTCCGTGGGTCTTCTCC