Previous Contig 006386:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012F15Sequence467006386 (7)764008769 (6)gb:AY045774_15612968e-77Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743
JMFF021L04Sequence568006386 (7)711008769 (6)gb:AY045774_15612969e-69Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743
JMFS074E09Sequence627006386 (7)
JMSF026I23Sequence620006386 (7)736008769 (6)gb:AY045774_15612965e-73Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743
JMSF029O13Sequence612006386 (7)734008769 (6)gb:AY045774_15612963e-71Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743
JMSF033G02Sequence631006386 (7)753008769 (6)gb:AY045774_15612963e-78Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743
JMSF053A07Sequence601006386 (7)860008769 (6)gb:AY045774_15612967e-82Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033G02+ ATCTTCAGCA
                      ____________________________________________________________
consensus ATCTTCAGCA
 
. : . : . : . : . : . :
JMSF033G02+ ACACCTCTCTCAAAAGCTCTATAGGCATGTTATTCCAGCAACTCTGCCTCAACCCCTCAT
                      ____________________________________________________________
consensus ACACCTCTCTCAAAAGCTCTATAGGCATGTTATTCCAGCAACTCTGCCTCAACCCCTCAT
 
. : . : . : . : . : . :
JMSF033G02+ CACCAAATTGACTCCCCTCACACGCCTCCTCCGCCTCCGCCACCGCCACCACAGAGCTGT
JMSF053A07+ TCCGCCACCGCCACCACAGAGCTGT
JMFS074E09+ GCCACCACAGAGCTGT
                      ____________________________________________________________
consensus CACCAAATTGACTCCCCTCACACGCCTCCTCCGCCTCCGCCACCGCCACCACAGAGCTGT
 
. : . : . : . : . : . :
JMSF033G02+ GCCGGCTCCTTGACCTGGACCCATAACCCCACTTCATCTCTCCGCCCGCTTCCACAACTC
JMSF053A07+ GCCGGCTCCTTGACCTGGACCCATAACCCCACTTCATCTCTCCGCCCGCTTCCACAACTC
JMFS074E09+ GCCGGCTCCTTGACCTGGACCCATAACCCCACTTCATCTCTCCGCCCGCTTCCACAACTC
JMSF029O13+ CCGCTTCCACAACTC
JMSF026I23+ TCCGCCCGCTTCCACAACTC
                      ____________________________________________________________
consensus GCCGGCTCCTTGACCTGGACCCATAACCCCACTTCATCTCTCCGCCCGCTTCCACAACTC
 
. : . : . : . : . : . :
JMSF033G02+ TCTTATCTACAACAACACAACTTTTTTGCACTACTTTCTAATTCCCCAAGAAAATAAATA
JMSF053A07+ TCTTATCTACAACAACACAACTTTTTTGCACTACTTTCTAATTCCCCAAGAAAATAAATA
JMFS074E09+ TCTTATCTACAACAACACAACTTTTTTGCACTACTTTCTAATTCCCCAAGAAAATAAATA
JMSF029O13+ TCTTATCTACAACAACACAACTTTTTTGCACTACTTTCTAATTCCCCAAGNAAATAAATA
JMFF021L04+ GCACTACTTTCTAATTCCCCAAGAAAATAAATA
JMSF026I23+ TCTTATCTACAACAACACAACTTTTTTGCACTACTTTCTAATTCCCCAAGAAAATAAATA
                      ____________________________________________________________
consensus TCTTATCTACAACAACACAACTTTTTTGCACTACTTTCTAATTCCCCAAGAAAATAAATA
 
. : . : . : . : . : . :
JMSF033G02+ ATGCCCAGGAAAGTAATTGGCCTTCAATTCAGATCTGAAACAAGACTTCACTAAATTATG
JMSF053A07+ ATGCCCAGGAAAGTAATTGGCCTTCAATTCAGATCTGAAACAAGACTTCACTAAATTATG
JMFS074E09+ ATGCCCAGGAAAGTAATTGGCCTTCAATTCAGATCTGAAACAAGACTTCACTAAATTATG
JMSF029O13+ ATGCCCAGGAAAGTAATTGGCCTTCAATTCAGATCTGAANCAAGACTTCACTAAATTATG
JMFF021L04+ ATG-CCAGGAAAGTAATTGGCCTTCAATTCAGATCTGAAACAAGACTTCACTAAATTATG
JMSF026I23+ ATGCCCAGGAAAGTAATTGGCCTTCAATTCAGATCTGAAACAAGACTTCACTAAATTATG
                      ____________________________________________________________
consensus ATGCCCAGGAAAGTAATTGGCCTTCAATTCAGATCTGAAACAAGACTTCACTAAATTATG
 
. : . : . : . : . : . :
JMSF033G02+ ATAAAGATCACACCTTTACGCACATCCACCGACATAAATGGAACAACACTCCGTTCTCAC
JMSF053A07+ ATAAAGATCACACCTTTACGCACATCCACCGACATAAATGGAACAACACTCCGTTCTCAC
JMFS074E09+ ATAAAGATCACACCTTTACGCACATCCACCGACATAAATGGAACAACACTCCGTTCTCAC
JMSF029O13+ ATAAAGATCACACCTTTACGCACATCCACCGACATAAATGGAACAACACTCCGTTCTCAC
JMFF021L04+ ATAAAGATCACACCTTTACGCACATCCACCGACATAAATGGAACAACACTCCGTTCTCAC
JMFF012F15+ CCTTTACGCACATCCACCGACATAAATGGAACAACACTCCGTTCTCAC
JMSF026I23+ ATAAAGATCACACCTTTACGCACATCCACCGACATAAATGGAACAACACTCCGTTCTCAC
                      ____________________________________________________________
consensus ATAAAGATCACACCTTTACGCACATCCACCGACATAAATGGAACAACACTCCGTTCTCAC
 
. : . : . : . : . : . :
JMSF033G02+ GGGGAAACAATAGATTTCTTGCACTAAAGCACAGATTTACAGAACCCAGAGCTCAAAGTC
JMSF053A07+ GGGGAAACAATAGATTTCTTGCACTAAAGCACAGATTTACAGAACCCAGAGCTCAAAGTC
JMFS074E09+ GGGGAAACAATAGATTTCTTGCACTAAAGCACAGATTTACAGAACCCAGAGCTCAAAGTC
JMSF029O13+ GGGGAAACNATAGATTTCTTGCACTAAAGCACAGATTTACAGAACCCAGAGCTCAAAGTC
JMFF021L04+ GGGGAAACAATAGATTTCTTGCACTAAAGCACAGATTTACAGAACCCAGAGCTCAAAGTC
JMFF012F15+ GGGGAAACAATAGATTTCTTGCACTAAAGCACAGATTTACAGAACCCAGAGCTCAAAGTC
JMSF026I23+ GGGGAAACAATAGATTTCTTGCACTAAAGCACAGATTTACAGAACCCAGAGCTCAAAGTC
                      ____________________________________________________________
consensus GGGGAAACAATAGATTTCTTGCACTAAAGCACAGATTTACAGAACCCAGAGCTCAAAGTC
 
. : . : . : . : . : . :
JMSF033G02+ ATTAAACAAATGAAATTACTCGAAAAACAACACAGGAATCTATATATCTGATCATACGAA
JMSF053A07+ ATTAAACAAATGAAATTACTCGAAAAACAACACAGGAATCTATATATCTGATCATACGAA
JMFS074E09+ ATTAAACAAATGAAATTACTCGAAAAACAACACAGGAATCTATATATCTGATCATACGAA
JMSF029O13+ ATTAAACAAATGAAATTACTCGAAAAACAACACAGGAATCTATATATCTGATCNTACGAA
JMFF021L04+ ATTAAACAAATGAAATTACTCGAAAAACAACACAGGAATCTATATATCTGATCATACGAA
JMFF012F15+ ATTAAACAAATGAAATTACTCGAAAAACAACACAGGAATCTATATATCTGATCATACGAA
JMSF026I23+ ATTAAACAAATGAAATTACTCGAAAAACAACACAGGAATCTATATATCTGATCATACGAA
                      ____________________________________________________________
consensus ATTAAACAAATGAAATTACTCGAAAAACAACACAGGAATCTATATATCTGATCATACGAA
 
. : . : . : . : . : . :
JMSF033G02+ TCCCATATATAAATAAACAAATAAAACTACATTTGCATCGATAGATTTTTAGGGTAGTTG
JMSF053A07+ TCACATATATAAATAAACAAATAAAACTACATTTGCATCGATAGATTTTTAGGGTAGTTG
JMFS074E09+ TCCCATATATAAATAAACAAATAAAACTACATTTGCATCGATAGATTTTTAGGGTAGTTG
JMSF029O13+ TCCCATATATAAATAAACAAATAAAACTACATTTGCATCGATAGATTTTTAGGGTAGTTG
JMFF021L04+ TCCCATATATAAATAAACAAATAAAACTACATTTGCATCGATAGATTTTTAGGGTAGTTG
JMFF012F15+ TCCCATATATAAATAAACAAATAAAACTACATTTGCATCGATAGATTTTTAGGGTAGTTG
JMSF026I23+ TCCCATATATAAATAAACAAATAAAACTACATTTGCATCGATAGATTTTTAGGGTAGTTG
                      ____________________________________________________________
consensus TCCCATATATAAATAAACAAATAAAACTACATTTGCATCGATAGATTTTTAGGGTAGTTG
 
. : . : . : . : . : . :
JMSF033G02+ GCCTATTAAGGATTAGGTTGGGAAGAAGAGGAAAGAAAAATGTACAGCAAATAGGAGTGT
JMSF053A07+ GCCTATTAAGGATTAGGTTGGGAAGAAGAGGAAAGAAAAATGTACAGCAAATAGGAGTGT
JMFS074E09+ GCCTATTAAGGATTAGGTTGGGAAGAAGAGGAAAGAAAAATGTACAGCAAATAGGAGTGT
JMSF029O13+ GCCTATTAAGGATTAGGTTGGGAAGAAGAGGAAAGAAAAATGTACAGCAAATAGGAGTGT
JMFF021L04+ GCCTATTAAGGATTAGGTTGGGAAGAAGAGGAAAGAAAAATGTACAGCAAATAGGAGTGT
JMFF012F15+ GCCTATTAAGGATTAGGTTGGGAAGAAGAGGAAAGAAAAATGTACAGCAAATAGGAGTGT
JMSF026I23+ GCCTATTAAGGATTAGGTTGGGAAGAAGAGGAAAGAAAAATGTACAGCAAATAGGAGTGT
                      ____________________________________________________________
consensus GCCTATTAAGGATTAGGTTGGGAAGAAGAGGAAAGAAAAATGTACAGCAAATAGGAGTGT
 
. : . : . : . : . : . :
JMSF033G02+ ACTTTTGTGCAAAGTCCGA
JMSF053A07+ ACTTTTGTGCAAAGTCCGATAACCACAAGAAGATTCAGAGAAGGGTTTTATTCTTTTAGG
JMFS074E09+ ACTTTTGTGCAAAGTCCGATAACCACAAGAAGATTCAGAGAAGGGTTTTATTCTTTTAGG
JMSF029O13+ ACTTTTGTGCAAAGTCCGATAACCACAAGAAGATTCAGAGAAGGGTTTTATTCTTTTAGG
JMFF021L04+ ACTTTTGTGCAAAGTCCGATAACCACAAGAAGATTCAGAGAAGGGTTTTATTCTTTTAGG
JMFF012F15+ ACTTTTGTGCAAAGTCCGATAACCACAAGAAGATTCAGAGAAGGGTTTTATTCTTTTAGG
JMSF026I23+ ACTTTTGTGCAAAGTCCGATAACCACAAGAAGATTCAGAGAAGGGTTTTATTCTTTTAGG
                      ____________________________________________________________
consensus ACTTTTGTGCAAAGTCCGATAACCACAAGAAGATTCAGAGAAGGGTTTTATTCTTTTAGG
 
. : . : . : . : . : . :
JMSF053A07+ ATTTGAGCCGACTAAGCTGGAAGAAGAGGGA
JMFS074E09+ ATTTGAGCCGACTAAGCTGGAAGAAGAGGGACTGAGGGATGGGGTGGGGTGGGGGTGGTT
JMSF029O13+ ATTTGAGCCGACTAAGCTGGAAGAAGAGGGACTGAGGGATGGGGTGGGGTGGGGGTGGTT
JMFF021L04+ ATTTGAGCCGACTAAGCTGGAAGAAGAGGGACTGAGGGATGGGGTGGGGTGGGGGTGGTT
JMFF012F15+ ATTTGAGCCGACTAAGCTGGAAGAAGAGGGACTGAGGGATGGGGTGGGGTGGGGGTGGTT
JMSF026I23+ ATTTGAGCCGACTAAGCTGGAAGAAGAGGGACTGAGGGATGGGGTGGGGTGGGGGTGGTT
                      ____________________________________________________________
consensus ATTTGAGCCGACTAAGCTGGAAGAAGAGGGACTGAGGGATGGGGTGGGGTGGGGGTGGTT
 
. : . : . : . : . : . :
JMFS074E09+ AAAGAATAAAA
JMSF029O13+ AAAGAATAAAAGACTCGAGAGAGAGTGCTAGTGGACAATGGACATAGAGATGAA
JMFF021L04+ AAAGAATAAAAGACTCGAGAGAGAGTGCTAGTGGACAATGGACATAGAGATGAA
JMFF012F15+ AAAGAATAAAAGACTCGAGAGAGAGTGCTAGTGGACAATGGACATAGAGATGAA
JMSF026I23+ AAAGAATAAAAGACTCGAGAGAGAGTGCTAGTGGACAATGGACATAGAGATGAATCATTC
                      ____________________________________________________________
consensus AAAGAATAAAAGACTCGAGAGAGAGTGCTAGTGGACAATGGACATAGAGATGAATCATTC