Previous Contig 006385:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026I22Sequence395006385 (2)648023232gb:AE016959_10231834e-20Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMSF040P18Sequence628006385 (2)pir|T51260|T512604e-09hypothetical protein T8M16_50 - Arabidopsis thaliana>gb:ATT8M16_1556486 Arabidop859011470 (3)pir|T51260|T512602e-40hypothetical protein T8M16_50 - Arabidopsis thaliana>gb:ATT8M16_1556486 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040P18+ TTCTATGTGCTAAATTTTCAT
                      ____________________________________________________________
consensus TTCTATGTGCTAAATTTTCAT
 
. : . : . : . : . : . :
JMSF040P18+ ACTTGTCTCGGTAGTGTCTGTCAACATGGCGTGCATAGTCTCTGGAACGATGATCATTAT
                      ____________________________________________________________
consensus ACTTGTCTCGGTAGTGTCTGTCAACATGGCGTGCATAGTCTCTGGAACGATGATCATTAT
 
. : . : . : . : . : . :
JMSF040P18+ CTCTCCTTGAATGATCTGAATAATGTTTATCTCTAGAGTCCCGGAGAGAATGAGAAGATG
                      ____________________________________________________________
consensus CTCTCCTTGAATGATCTGAATAATGTTTATCTCTAGAGTCCCGGAGAGAATGAGAAGATG
 
. : . : . : . : . : . :
JMSF040P18+ ATTTTGAATAATATCTATCATCATTATCTTCATTCTTGCCAGGTCGTGAATAGTCATCAT
                      ____________________________________________________________
consensus ATTTTGAATAATATCTATCATCATTATCTTCATTCTTGCCAGGTCGTGAATAGTCATCAT
 
. : . : . : . : . : . :
JMSF040P18+ GCTCAAGGTGCCTATGAGAACTTCTAGAAGATTGCTTATCAGAATGTTTACGTGACTCAC
                      ____________________________________________________________
consensus GCTCAAGGTGCCTATGAGAACTTCTAGAAGATTGCTTATCAGAATGTTTACGTGACTCAC
 
. : . : . : . : . : . :
JMSF040P18+ TGCTCCTGGCCTGTTGTCTCCAGTCTCTACCTGAATCCCTTTCATCATCTGGCCTTCTGT
                      ____________________________________________________________
consensus TGCTCCTGGCCTGTTGTCTCCAGTCTCTACCTGAATCCCTTTCATCATCTGGCCTTCTGT
 
. : . : . : . : . : . :
JMSF040P18+ GATCATCAACAGTTTTTTCAGGATTCTTCCTTCTTTGAATTGGACTGGAACTCCTACTAC
                      ____________________________________________________________
consensus GATCATCAACAGTTTTTTCAGGATTCTTCCTTCTTTGAATTGGACTGGAACTCCTACTAC
 
. : . : . : . : . : . :
JMSF040P18+ GGACAGGACTACCGTCGGCTGATGCTGAGCCACCAACTGGAGACCGGCGCCGATATTTTC
JMSF026I22+ TGAGCCACCAACTGGAGACCGGCGCCGATATTTTC
                      ____________________________________________________________
consensus GGACAGGACTACCGTCGGCTGATGCTGAGCCACCAACTGGAGACCGGCGCCGATATTTTC
 
. : . : . : . : . : . :
JMSF040P18+ GATTAGTTGTGTCGGTCGACAGCCTACGGAATGCACCTTTAGCATCAAATTGATCACCGG
JMSF026I22+ GATTAGTTGTGTCGGTCGACAGCCTACGGAATGCACCTTTAGCATCAAATTGATCACCGG
                      ____________________________________________________________
consensus GATTAGTTGTGTCGGTCGACAGCCTACGGAATGCACCTTTAGCATCAAATTGATCACCGG
 
. : . : . : . : . : . :
JMSF040P18+ AAGATGTTTGTCCGTTTGAGTCCATGTTATAGCCAAAAACT
JMSF026I22+ AAGATGTTTGTCCGTTTGAGTCCATGTTATAGCCAAAAACTGAATCCACAAGTATTCCAC
                      ____________________________________________________________
consensus AAGATGTTTGTCCGTTTGAGTCCATGTTATAGCCAAAAACTGAATCCACAAGTATTCCAC
 
. : . : . : . : . : . :
JMSF026I22+ AGCTAAAATTAAACATTCAAAACCAAGTTTTACAGGTTTACAATGTATATATCATATGAT
                      ____________________________________________________________
consensus AGCTAAAATTAAACATTCAAAACCAAGTTTTACAGGTTTACAATGTATATATCATATGAT
 
. : . : . : . : . : . :
JMSF026I22+ CCGGAAGTTCATAAAAAAATGGATTAGACGAACGAACCTTNTGAGTTGTTCGCTTTTGTT
                      ____________________________________________________________
consensus CCGGAAGTTCATAAAAAAATGGATTAGACGAACGAACCTTNTGAGTTGTTCGCTTTTGTT
 
. : . : . : . : . : . :
JMSF026I22+ TATTCCCTNGGCTCTGTATCCGACTTCCTGTTTAGGGTTTCGATTTCCGCTTTGAAAAGA
                      ____________________________________________________________
consensus TATTCCCTNGGCTCTGTATCCGACTTCCTGTTTAGGGTTTCGATTTCCGCTTTGAAAAGA
 
. : . : . : . : . : . :
JMSF026I22+ AGCTGAAAATGGTAAATGAGTTCTGAAATATTTAAAATATTTCCTTTCAAATTTTCATTC
                      ____________________________________________________________
consensus AGCTGAAAATGGTAAATGAGTTCTGAAATATTTAAAATATTTCCTTTCAAATTTTCATTC