Previous Contig 006384:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039G15Sequence599006384 (3)gb:AY084538_15696279e-25Arabidopsis thaliana clone 111069 mRNA, complete sequence.710010032 (3)gb:BT003918_16370432e-25Arabidopsis thaliana clone RAFL15-10-H06 (R20674) putative F-box protein (At4g00
JMSF011C17Sequence300006384 (3)696010032 (3)gb:BT003918_16370431e-20Arabidopsis thaliana clone RAFL15-10-H06 (R20674) putative F-box protein (At4g00
JMSF026I18Sequence672006384 (3)gb:AY084538_15696277e-25Arabidopsis thaliana clone 111069 mRNA, complete sequence.708010032 (3)gb:BT003918_16370438e-33Arabidopsis thaliana clone RAFL15-10-H06 (R20674) putative F-box protein (At4g00

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF039G15+ TCCTT
JMSF026I18+ TACGCTGTCCTT
                      ____________________________________________________________
consensus TACGCTGTCCTT
 
. : . : . : . : . : . :
JMFF039G15+ TACTGGACCAGTATGAAGCTCTATTCAGATATCTTTCCCTTGGATATAGAGTATTGGCAA
JMSF026I18+ TACTGGACCAGTATGAAGCTCTATTCAGATATCTTTCCCTNGGATATAGAGTATTGGCAA
                      ____________________________________________________________
consensus TACTGGACCAGTATGAAGCTCTATTCAGATATCTTTCCCTTGGATATAGAGTATTGGCAA
 
. : . : . : . : . : . :
JMFF039G15+ TACTTTCAAGAGGATAATTGTCTGTACTCGAAGCCCCGATTGCATACTCAATACAATCAG
JMSF026I18+ TACTTTCAAGAGGATAATTGTCTGTACTCGAAGCCCCGATTGCATACTCAATACAATCAG
                      ____________________________________________________________
consensus TACTTTCAAGAGGATAATTGTCTGTACTCGAAGCCCCGATTGCATACTCAATACAATCAG
 
. : . : . : . : . : . :
JMFF039G15+ TTGGAGATAATGCTAGTGTCTCAAGAGCTTGAAGTAGAGAAGCATAAACCCTATGGTCTC
JMSF026I18+ TTGGAGATAATGCTAGTGTCTCAAGAGCTTGAAGTAGAGAAGCATAAACCCTATGGTCTC
                      ____________________________________________________________
consensus TTGGAGATAATGCTAGTGTCTCAAGAGCTTGAAGTAGAGAAGCATAAACCCTATGGTCTC
 
. : . : . : . : . : . :
JMFF039G15+ TCCTTAGAGTCTCGAAGTCAGAATTGCTAGATCCAACGACAGATGATTCATTCGTTCTGC
JMSF026I18+ TCCTTAGAGTCTCAAAGTCAGAATTGCTAGATCCAACAACAGATGATTCATTTGTTCTGC
                      ____________________________________________________________
consensus TCCTTAGAGTCTCGAAGTCAGAATTGCTAGATCCAACGACAGATGATTCATTTGTTCTGC
 
. : . : . : . : . : . :
JMFF039G15+ AACCTTGTTCGACTACGCGTGCAACACTGGAAAGCTGGGGAAACTTTCTTAAGCACAATT
JMSF026I18+ AACCTTCTTCGACTATGCATGCAACACCGGAAAGCTGGGGAAACTTTCTTAAGCACAATT
                      ____________________________________________________________
consensus AACCTTGTTCGACTATGCGTGCAACACTGGAAAGCTGGGGAAACTTTCTTAAGCACAATT
 
. : . : . : . : . : . :
JMFF039G15+ GCTTGGAAATTCCATTTTCGATCATACAAGTACGCCAGATGCGTGACACGGCTCCAGCAT
JMSF026I18+ GCTTGGAAATTCCATTTTCGATCATACAATGACGCCAGACGCGTGACACAGCTCCAGCAT
                      ____________________________________________________________
consensus GCTTGGAAATTCCATTTTCGATCATACAATTACGCCAGATGCGTGACACGGCTCCAGCAT
 
. : . : . : . : . : . :
JMFF039G15+ GCACCACATCAGCTGGATCACATAAACTCAGCATGATCTCCACGATCACATCCTTTTCAA
JMSF026I18+ GCACCACATCAGCTGGATCACATAAACTCAGCATGATCTCCACGATCACATCCTTTTCAA
                      ____________________________________________________________
consensus GCACCACATCAGCTGGATCACATAAACTCAGCATGATCTCCACGATCACATCCTTTTCAA
 
. : . : . : . : . : . :
JMFF039G15+ CGCATTGCAGAAAGTCAATTCTAGGCTCCATTACCGCTGACGAACAACCCATCAAACCTT
JMSF011C17+ TT
JMSF026I18+ CCCATTGCAGAAAGTCAATTCTAGGCTCCATTACCTCTGACAAACAGCCCATCAACCTTT
                      ____________________________________________________________
consensus CGCATTGCAGAAAGTCAATTCTAGGCTCCATTACCTCTGACGAACAGCCCATCAACCTTT
 
. : . : . : . : . : . :
JMFF039G15+ TTTGTGTTTCTTCCGTTAAATTGGAAGCAGAAAGATAATCAAAACTCTCAAGAGAAACAG
JMSF011C17+ TTTGTGTTTCTTCCGTTAAATTGGAAGCAGAAAGATAATCAAAACTCTGAAGAGAAACAG
JMSF026I18+ TTTGTGTTTCTTCCGTTAAATTGGAAGCAGAAAGATAATCAAAACTCTGAAGAGAAACAG
                      ____________________________________________________________
consensus TTTGTGTTTCTTCCGTTAAATTGGAAGCAGAAAGATAATCAAAACTCTGAAGAGAAACAG
 
. : . : . : . : . : . :
JMFF039G15+ AAATGAG
JMSF011C17+ AGATGAG
JMSF026I18+ AGATGAGTGTTCTAGAGAACGCGAAGTGGGTGTGTCTGGGTTCTACTTATCAATGCCCGA
                      ____________________________________________________________
consensus AGATGAGTGTTCTAGAGAACGCGAAGTGGGTGTGTCTGGGTTCTACTTATCAATGCCCGA
 
. : . : . : . : . : . :
JMSF026I18+ TTGGCCTCTCGGGCTCTGCCTCTGTCTGGTTCTCTAGGATTTTTTTCTTTTTCTTTTTTC
                      ____________________________________________________________
consensus TTGGCCTCTCGGGCTCTGCCTCTGTCTGGTTCTCTAGGATTTTTTTCTTTTTCTTTTTTC