Previous Contig 006374:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN039N19Sequence351006374 (5)gb:AY081696_15689563e-10Arabidopsis thaliana unknown protein (At3g07510) mRNA, complete cds.>gb:AF370475
JMSF023N07Sequence675006374 (5)gb:AY081696_15689562e-38Arabidopsis thaliana unknown protein (At3g07510) mRNA, complete cds.>gb:AF370475720006374 (5)gb:AY081696_15689564e-49Arabidopsis thaliana unknown protein (At3g07510) mRNA, complete cds.>gb:AF370475
JMSF026H03Sequence615006374 (5)gb:AY081696_15689569e-26Arabidopsis thaliana unknown protein (At3g07510) mRNA, complete cds.>gb:AF370475748006374 (5)gb:AY081696_15689564e-49Arabidopsis thaliana unknown protein (At3g07510) mRNA, complete cds.>gb:AF370475

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN039N19+ GAAAAATGAAAAACTGAAGAATTGAAAAGTATTTCCAGTTC
                      ____________________________________________________________
consensus GAAAAATGAAAAACTGAAGAATTGAAAAGTATTTCCAGTTC
 
. : . : . : . : . : . :
JMFN039N19+ AACTTAAAAGCTAGGACTCTGAAGCTTGAAGCCATACCAAATATGTATGGAAATGAGACA
rJMSF023N07- AGCCATACCAAATATGTAT-GAAATGAGACA
                      ____________________________________________________________
consensus AACTTAAAAGCTAGGACTCTGAAGCTTGAAGCCATACCAAATATGTATGGAAATGAGACA
 
. : . : . : . : . : . :
JMFN039N19+ ACAATTACACAACTAAAATCTCCGAAACACTAAAACTACTCATACAAATGATCAATTAAG
rJMSF023N07- ACAATTACACAACTAAAATCTCCGAAACACTAAAACTACTCATACAAATGATCAATTAAG
rJMSF026H03- CAACTAAAATCTCCGAAACACTAAAACTACTCATACAAATGATCAATTAAG
                      ____________________________________________________________
consensus ACAATTACACAACTAAAATCTCCGAAACACTAAAACTACTCATACAAATGATCAATTAAG
 
. : . : . : . : . : . :
JMFN039N19+ CTTTTAGCTGAATGGTTCAATTCAGTGCAGAAAAGCATAAATGACAGTTGAAATATAAAC
rJMSF023N07- CTTTTAGCTGAATGGTTCAATTCAGTGCAGAAAAGCATAAATGACAGTTGAAATATAAAC
rJMSF026H03- CTTTTAGCTGAATGGTTCAATTCAGTGCAGAAAAGCATAAATGACAGTTGAAATATAAAC
                      ____________________________________________________________
consensus CTTTTAGCTGAATGGTTCAATTCAGTGCAGAAAAGCATAAATGACAGTTGAAATATAAAC
 
. : . : . : . : . : . :
JMFN039N19+ AAGAAGAGCAGAGGTGACCAGAACCACCAAAACCGCCACAGTATGAACAGCAGATTTGCT
rJMSF023N07- AAGAAGAGCAGAGGTGACCAGAACCACCAAAACCGCCACAGTATGAACAGCAGATTTGCT
rJMSF026H03- AAGAAGAGCAGAGGTGACCAGAACCACCAAAACCGCCACAGTATGAACAGCAGATTTGCT
                      ____________________________________________________________
consensus AAGAAGAGCAGAGGTGACCAGAACCACCAAAACCGCCACAGTATGAACAGCAGATTTGCT
 
. : . : . : . : . : . :
JMFN039N19+ CCCACAAGACAGCATCCCCAGCCGGATCTCGATCACATTCACCATCGAAAGCATCAAGAA
rJMSF023N07- CCCACAAGACAGCATCCCCAGCCGGATCTCGATCACATTCACCATCGAAAGCATCAAGAA
rJMSF026H03- CCCACAAGACAGCATCCCCAGCCGGATCTCGATCACATTCACCATCGAAAGCATCAAGAA
JMSF023N07+ GATCACATTCACCATCGAAAGCATCAAGAA
                      ____________________________________________________________
consensus CCCACAAGACAGCATCCCCAGCCGGATCTCGATCACATTCACCATCGAAAGCATCAAGAA
 
. : . : . : . : . : . :
JMFN039N19+ CAGGCACCCC
rJMSF023N07- CAGGCACCCCATCACCGACCCAACCGCCGACGCCACCATCCCAAGTCGAAGAACCTTGGC
rJMSF026H03- CAGGCACCCCATCACCGACCCAACCGCCGACGCCACCATCCCAAGCCGAAGAACCTTGGC
JMSF023N07+ CAGGCACCCCATCACCGACCCAACCGCCGACGCCACCATCCCAAGTCGAAGAACCTTGGC
JMSF026H03+ CGAAGAACCTTGGC
                      ____________________________________________________________
consensus CAGGCACCCCATCACCGACCCAACCGCCGACGCCACCATCCCAAGTCGAAGAACCTTGGC
 
. : . : . : . : . : . :
rJMSF023N07- GTTCACATGCGCCCTGAACGCCTCGTCCGCTTCCTTGCTGTTCAGCAGATTAATGGCGAG
rJMSF026H03- GTTCACATGCGCCCTGAACGCCTCGTCCGCTTCCTTGCTGTTCAGCAGATTAATGGCGAG
JMSF023N07+ GTTCACATGCGCCCTGAACGCCTCGTCCGCTTCCTTGCTGTTCAGCAGATTAATGGCGAG
JMSF026H03+ GTTCACATGCGCCCTGAACGCCTCGTCCGCTTCCTTGCTGTTCAGCAGATTAATGGCGAG
                      ____________________________________________________________
consensus GTTCACATGCGCCCTGAACGCCTCGTCCGCTTCCTTGCTGTTCAGCAGATTAATGGCGAG
 
. : . : . : . : . : . :
rJMSF023N07- TTTCAGGCCCTGAGCCACCAGGGAAGAGAAGAGGAAGAAGCTGAAAGAGACGACCTCGAA
rJMSF026H03- TTTCAGGCCCTGAGCCACCAGGGAAGAGAAGAGGAAGAAGCTGAAAGAGACGACCTCGAA
JMSF023N07+ TTTCAGGCCCTGAGCCACCAGGGAAGAGAAGAGGAAGAAGCTGAAAGAGACGACCTCGAA
JMSF026H03+ TTTCAGGCCCTGAGCCACCAGGGAAGAGAAGAGGAAGAAGCTGAAAGAGACGACCTCGAA
                      ____________________________________________________________
consensus TTTCAGGCCCTGAGCCACCAGGGAAGAGAAGAGGAAGAAGCTGAAAGAGACGACCTCGAA
 
. : . : . : . : . : . :
rJMSF023N07- AACCAGGAGTTTCTTCACCACATCGATCCCCGCGTCGCAGCTGGACCGCTCTTCCAGGCT
rJMSF026H03- AACCAGGAGTTTCTTCACCACATCGATCCCCGCGTCGCAGCTGGACCGCTCTTCCAGGCT
JMSF023N07+ AACCAGGAGTTTCTTCACCACATCGATCCCCGCGTCGCAGCTGGACCGCTCTTCCAGGCT
JMSF026H03+ AACCAGGAGTTTCTTCACCACATCGATCCCCGCGTCGCAGCTGGACCGCTCTTCCAGGCT
                      ____________________________________________________________
consensus AACCAGGAGTTTCTTCACCACATCGATCCCCGCGTCGCAGCTGGACCGCTCTTCCAGGCT
 
. : . : . : . : . : . :
rJMSF023N07- CTTCTGCCCCGGAGTGGCCAGGGAAAGCCCCACGAACACCGCCACGGTGAAGAGGGAGTT
rJMSF026H03- CTTCTGCCCCGGAGTGGCCAGGGAAAGCCCCACGAACACCGCCACGGTGAAGAGGGAGTT
JMSF023N07+ CTTCTGCCCCGGAGTGGCCAGGGAAAGCCCCACGAACACCGCCACGGTGAAGAGGGAGTT
JMSF026H03+ CTTCTGCCCCGGAGTGGCCAGGGAAAGCCCCACGAACACCGCCACGGTGAAGAGGGAGTT
                      ____________________________________________________________
consensus CTTCTGCCCCGGAGTGGCCAGGGAAAGCCCCACGAACACCGCCACGGTGAAGAGGGAGTT
 
. : . : . : . : . : . :
rJMSF023N07- CACGTTCACCAGCCCGTCCAGCGCCGTCACGTGGACGCTGGTGGTGGACGACGACGGCGT
rJMSF026H03- CACGTTCACCAGCCCGTCCAGCGCCGTCACGTGGACGCTGGTGGTGGACGACGACGGCGT
JMSF023N07+ CACGTTCACCAGCCCGTCCAGCGCCGTCACGTGGACGCTGGTGGTGGACGACGACGGCGT
JMSF026H03+ CACGTTCACCAGCCCGTCCAGCGCCGTCACGTGGACGCTGGTGGTGGACGACGACGGCGT
                      ____________________________________________________________
consensus CACGTTCACCAGCCCGTCCAGCGCCGTCACGTGGACGCTGGTGGTGGACGACGACGGCGT
 
. : . : . : . : . : . :
rJMSF023N07- CGAGGCGGCGGCTCTTCCGGATTGCGGCGAGGAGTAATACGGATATGCTTCAGATTCATC
rJMSF026H03- CGAGGCGGCGGCTCTTCCGGATTGCGGCGAGGAGTAATACGGATATGCTTCAGATTCATC
JMSF023N07+ CGAGGCGGCGGCTCTTCCGGATTGCGGCGAGGAGTAATACGGATATGCTTCAGATTCATC
JMSF026H03+ CGAGGCGGCGGCTCTTCCGGATTGCGGCGAGGAGTAATACGGATATGCTTCAGATTCATC
                      ____________________________________________________________
consensus CGAGGCGGCGGCTCTTCCGGATTGCGGCGAGGAGTAATACGGATATGCTTCAGATTCATC
 
. : . : . : . : . : . :
rJMSF023N07- CATGGCGTCTGAACTGATTGTTGTTTGAGC
rJMSF026H03- CATGGCGTCTGAACTGATTGTTGTTTGAGCTAAAAGATAATGCTCGGAGATTGTGATTGC
JMSF023N07+ CATGGCGTCTGAACTGATTGTTGTTTGAGCTAAAAGATAATGCTCGGAGATTGTGATTGC
JMSF026H03+ CATGGCGTCTGAACTGATTGTTGTTTGAGCTAAAAGATAATGCTCGGAGATTGTGATTGC
                      ____________________________________________________________
consensus CATGGCGTCTGAACTGATTGTTGTTTGAGCTAAAAGATAATGCTCGGAGATTGTGATTGC
 
. : . : . : . : . : . :
rJMSF026H03- TTCAAGGGTTTTGATGTATAAAGGAAAAGGTAGGCTA
JMSF023N07+ TTCAAGGGTTTTGATGTATAAAGGAAAAGGTAGGCTAATGAAATTGAAAAAGGGGGAAAC
JMSF026H03+ TTCAAGGGTTTTGATGTATAAAGGAAAAGGTAGGCTAATGAAATTGAAAAAGGGGGAAAC
                      ____________________________________________________________
consensus TTCAAGGGTTTTGATGTATAAAGGAAAAGGTAGGCTAATGAAATTGAAAAAGGGGGAAAC
 
. : . : . : . : . : . :
JMSF023N07+ TTTTTGCTTTACACATTTGATCTCTTCTCTGTGTTCCGGAAGTAGGTGAGAGAATGGAGT
JMSF026H03+ TTTTTGCTTTACACATTTGATCTCTTCTCTGTGTTCCGGAAGTAGGTGAGAGAATGGAGT
                      ____________________________________________________________
consensus TTTTTGCTTTACACATTTGATCTCTTCTCTGTGTTCCGGAAGTAGGTGAGAGAATGGAGT
 
. : . : . : . : . : . :
JMSF023N07+ CGGATTTCATGGAGCGAGAGGAACACGGAAGGGCTCAATTAGTT
JMSF026H03+ CGGATTTCATGGAGCGAGAGGAACACGGAAGGGCTCAATTAGTTAGAAATCCCTATCTCC
                      ____________________________________________________________
consensus CGGATTTCATGGAGCGAGAGGAACACGGAAGGGCTCAATTAGTTAGAAATCCCTATCTCC