Previous Contig 006369:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K10Sequence519006369 (4)
JMFF035B18Sequence585006369 (4)664010877 (6)gb:AC079021_15416821e-22Oryza sativa (japonica cultivar-group) chromosome 5 clone P0008A07, complete seq
JMFF049B19Sequence624006369 (4)gb:AY057527_15639458e-04Arabidopsis thaliana AT5g03040/F15A17_70 mRNA, complete cds.>gb:AY143972_1583429612010877 (6)gb:AC079021_15416829e-23Oryza sativa (japonica cultivar-group) chromosome 5 clone P0008A07, complete seq
JMSF026F18Sequence680006369 (4)gb:AY057527_15639455e-07Arabidopsis thaliana AT5g03040/F15A17_70 mRNA, complete cds.>gb:AY143972_1583429741010877 (6)gb:AC079021_15416821e-29Oryza sativa (japonica cultivar-group) chromosome 5 clone P0008A07, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026F18+ GTCTCACAAGTCCTCTCGAAC
                      ____________________________________________________________
consensus GTCTCACAAGTCCTCTCGAAC
 
. : . : . : . : . : . :
JMFF049B19+ CGAAACGCAGTCTGGATTCTGATTGCTGCAGC
JMSF026F18+ CTTAAAAGCTGTTCTAGTCTGGTACCCACGAAACGCAGTCTGGATTCTGATTGCTGCAGC
                      ____________________________________________________________
consensus CTTAAAAGCTGTTCTAGTCTGGTACCCACGAAACGCAGTCTGGATTCTGATTGCTGCAGC
 
. : . : . : . : . : . :
JMFF049B19+ TTCTTCCTTGGACTTGCCTGAAAACTTGNCGGGTGCAGTTGATTGAACAACAACCTTT-G
JMFF035B18+ TGGACTTGCCTGAAAACTTNGCGGGTGCAGTTGATTGAACAACAACCTTTGG
JMFF005K10+ TGGACTTGCCTGAAAACTTTGCGGGTGCAGTTGATTGAACAACAACCTTT-G
JMSF026F18+ TTCTTCCTTGGACTTGCCTGAAAACTTTGCGGGTGCAGTTGATTGAACAACAACCTTT-G
                      ____________________________________________________________
consensus TTCTTCCTTGGACTTGCCTGAAAACTTTGCGGGTGCAGTTGATTGAACAACAACCTTT-G
 
. : . : . : . : . : . :
JMFF049B19+ CAGCAGCCTCGTCTTCTTCCTTGGATTTGCCCGAAAGCTTTGCAACTGCAGCTGATTGAA
JMFF035B18+ CAGCAGCCTCGTCTTCTTCCTTGGATTTGCCCGAAAGCTTTGCAACTGCAGCTGATTGAA
JMFF005K10+ CAGCAGCCTCGTCTTCTTCCTTGGATTTGCCCGAAAGCTTTGCAACTGCAGCTGATTGAA
JMSF026F18+ CAGCAGCCTCGTCTTCTTCCTTGGATTTGCCCGAAAGCTTTGCAACTGCAGCTGATTGAA
                      ____________________________________________________________
consensus CAGCAGCCTCGTCTTCTTCCTTGGATTTGCCCGAAAGCTTTGCAACTGCAGCTGATTGAA
 
. : . : . : . : . : . :
JMFF049B19+ CAGCTTCTGCAATAGCATCTTCAGCCACTGCAGCTGTGGCAACTTCTTTCTCGACTTCTG
JMFF035B18+ CAGCTTCTGCAATAGCATCTTCAGCCACTGCAGCTGTGGCAACTTCTTTCTCGACTTCTG
JMFF005K10+ CAGCTTCTGCAATAGCATCTTCAGCCACTGCAGCTGTGGCAACTTCTTTCTCGACTTCTG
JMSF026F18+ CAGCTTCTGCAATAGCATCTTCAGCCACTGCAGCTGTGGCAACTTCTTTCTCGACTTCTG
                      ____________________________________________________________
consensus CAGCTTCTGCAATAGCATCTTCAGCCACTGCAGCTGTGGCAACTTCTTTCTCGACTTCTG
 
. : . : . : . : . : . :
JMFF049B19+ CCAATTTTACCTCTTCCAGATGAGGAGGTGAGGCAGCAGTGGAAGTCTCGAGAGTTGCAG
JMFF035B18+ CCAATTTTACCTCTTCCAGATGAGGAGGTGAGGCAGCAGTGGAAGTCTCGAGAGTTGCAG
JMFF005K10+ CCAATTTTACCTCTTCCAGATGAGGAGGTGAGGCAGCAGTGGAAGTCTCGAGAGTTGCAG
JMSF026F18+ CCAATTTTACCTCTTCCAGATGAGGAGGTGAGGCAGCAGTGGAAGTCTCGAGAGTTGCAG
                      ____________________________________________________________
consensus CCAATTTTACCTCTTCCAGATGAGGAGGTGAGGCAGCAGTGGAAGTCTCGAGAGTTGCAG
 
. : . : . : . : . : . :
JMFF049B19+ AATTCGGAACGTGAAGCTTCTCCTTTCCCAACAATCTGTTCTTCGATTTATTTGCTTTCT
JMFF035B18+ AATTCGGAACGTGAAGCTTCTCCTTTCCCAACAATCTGTTCTTCGATTTATTTGCTTTCT
JMFF005K10+ AATTCGGAACGTGAAGCTTCTCCTTTCCCAACAATCTGTTCTTCGATTTATTTGCTTTCT
JMSF026F18+ AATTCGGAACGTGAAGCTTCTCCTTTCCCAACAATCTGTTCTTCGATTTATTTGCTTTCT
                      ____________________________________________________________
consensus AATTCGGAACGTGAAGCTTCTCCTTTCCCAACAATCTGTTCTTCGATTTATTTGCTTTCT
 
. : . : . : . : . : . :
JMFF049B19+ GTTCCTTCTTTTCCTTAGATTCTGGGCTGAATGCCTTCTTCACTGAAGAAAACCAGCTCC
JMFF035B18+ GTTCCTTCTTTTCCTTAGATTCTGGGCTGAATGCCTTCTTCACTGAAGAAAACCAGCTCC
JMFF005K10+ GTTCCTTCTTTTCCTTAGATTCTGGGCTGAATGCCTTCTTCACTGAAGAAAACCAGCTCC
JMSF026F18+ GTTCCTTCTTTTCCTTAGATTCTGGGCTGAATGCCTTCTTCACTGAAGAAAACCAGCTCC
                      ____________________________________________________________
consensus GTTCCTTCTTTTCCTTAGATTCTGGGCTGAATGCCTTCTTCACTGAAGAAAACCAGCTCC
 
. : . : . : . : . : . :
JMFF049B19+ CCTTCCTCCCCATTCTTTTATAAGTCTGTGAATGAGAGTTCCCAGATCTCAGAAAGCTTC
JMFF035B18+ CCTTCCTCCCCATTCTTTTATAAGTCTGTGAATGAGAGTTCCCAGATCTCAGAAAGCTTC
JMFF005K10+ CCTTCCTCCCCATTCTTTTATAAGTCTGTGAATGAGAGTTCCCAGATCTCAGAAAGCTTC
JMSF026F18+ CCTTCCTCCCCATTCTTTTATAAGTCTGTGAATGAGAGTTCCCAGATCTCAGAAAGCTTC
                      ____________________________________________________________
consensus CCTTCCTCCCCATTCTTTTATAAGTCTGTGAATGAGAGTTCCCAGATCTCAGAAAGCTTC
 
. : . : . : . : . : . :
JMFF049B19+ CATTGTTGTTCTATATATACAGAGTTTCTTTTCTGTGAAACAAAAAGACTAGAAAGAGAG
JMFF035B18+ CATTGTTGTTCTATATATACAGAGTTTCTTTTCTGTGAAACAAAAAGACTAGAAAGAGAG
JMFF005K10+ CATTGTTGTTCTATATATACAGAGTTTCTTTTCTGTGAAACAAAAAGACTAGAAAGAGAG
JMSF026F18+ CATTGTTGTTCTATATATACAGAGTTTCTTTTCTGTGAAACAAAAAGACTAGAAAGAGAG
                      ____________________________________________________________
consensus CATTGTTGTTCTATATATACAGAGTTTCTTTTCTGTGAAACAAAAAGACTAGAAAGAGAG
 
. : . : . : . : . : . :
JMFF049B19+ ATTGTGCCCTCCTCCCTGAATATCCATTGGTAGTGAAAGAGAAAGAGAAAGATCAGATCT
JMFF035B18+ ATTGTGCCCTCCTCCCTGAATATCCATTGGTAGTGAAAGAGAAAGAGAAAGATCAGATCT
JMFF005K10+ ATTGTGCCCTCCTCCCTGAATATCCATTGGTAGTGAAAGAGAAAGAG
JMSF026F18+ ATTGTGCCCTCCTCCCTGAATATCCATTGGTAGTGAAAGAGAAAGAGAAAGATCAGATCT
                      ____________________________________________________________
consensus ATTGTGCCCTCCTCCCTGAATATCCATTGGTAGTGAAAGAGAAAGAGAAAGATCAGATCT
 
. : . : . : . : . : . :
JMFF049B19+ TTCCAAAGAGAAGTTCAACTACTGTGTCTGTAGAACGTGAAGAATACCAACT
JMFF035B18+ TTCCAAAGAGAAGTTCAACTACTGTGTCTGTAGAACGTGAAGAATACCAACT
JMSF026F18+ TTCCAAAGAGAAGTTCAACTACTGTGTCTGTAGAACGTGAAGAATACCAACTGGCCTCAA
                      ____________________________________________________________
consensus TTCCAAAGAGAAGTTCAACTACTGTGTCTGTAGAACGTGAAGAATACCAACTGGCCTCAA