Previous Contig 006368:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026F14Sequence183006368 (2)129006368 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF026F14+ GAT
JMSF026F14- GAT
                      ____________________________________________________________
consensus GAT
 
. : . : . : . : . : . :
rJMSF026F14+ GGTCTCTTCAAATTTATAAAATCTCTTCGCTTGTAATTTCTTAATATTTTAAACTTTATA
JMSF026F14- GGTCTCTTCAAATTTATAAAATCTCTTCGCTTGTAATTTCTTAATATTTTAAACTTTATA
                      ____________________________________________________________
consensus GGTCTCTTCAAATTTATAAAATCTCTTCGCTTGTAATTTCTTAATATTTTAAACTTTATA
 
. : . : . : . : . : . :
rJMSF026F14+ CAAATGCTTCATTCATGAAAATGTATTTGATTGCAGTGATGTATGTATAAATTCAATGCA
JMSF026F14- CAAATGCTTCATTCATGAAAATGTATTTGATTGCAGTGATGTATGTATAAATTCAATGCA
                      ____________________________________________________________
consensus CAAATGCTTCATTCATGAAAATGTATTTGATTGCAGTGATGTATGTATAAATTCAATGCA
 
. : . : . : . : . : . :
rJMSF026F14+ CTCACA
JMSF026F14- CTCACAGTAAACATAATGTGTAATCTTTGCATGTGAAGTATTCTAAGTGCAAAAAAAAAA
                      ____________________________________________________________
consensus CTCACAGTAAACATAATGTGTAATCTTTGCATGTGAAGTATTCTAAGTGCAAAAAAAAAA