Previous Contig 006356:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022P20Sequence544006356 (4)gb:AY099728_15767538e-19Arabidopsis thaliana putative protein (At4g35760) mRNA, complete cds.>gb:AY12890767009280 (3)gb:AY099728_15767533e-43Arabidopsis thaliana putative protein (At4g35760) mRNA, complete cds.>gb:AY12890
JMFF038M04Sequence612006356 (4)gb:AY099728_15767531e-18Arabidopsis thaliana putative protein (At4g35760) mRNA, complete cds.>gb:AY12890766009280 (3)gb:AY099728_15767534e-43Arabidopsis thaliana putative protein (At4g35760) mRNA, complete cds.>gb:AY12890
JMSF019E02Sequence313006356 (4)742009280 (3)gb:AY099728_15767533e-61Arabidopsis thaliana putative protein (At4g35760) mRNA, complete cds.>gb:AY12890
JMSF026C20Sequence649006356 (4)gb:AY099728_15767531e-18Arabidopsis thaliana putative protein (At4g35760) mRNA, complete cds.>gb:AY12890

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF038M04+ AGATTACAGAGTATGAAGCGGCACAAGTTCACTAGGGGCACTGGGGCA
JMSF026C20+ GAGATTACAGAGTATGAAGCGGCACAAGTTCACTAGGGGCACTGGGGCA
                      ____________________________________________________________
consensus GAGATTACAGAGTATGAAGCGGCACAAGTTCACTAGGGGCACTGGGGCA
 
. : . : . : . : . : . :
JMFF038M04+ GATCATTCACGAAATGAGANCAGAAATTAAGAGTAGCAATACTGAAGGAAATAAAAATAT
JMFF022P20+ CAGAAATTAAGAGTAGCAATACTGAAGGAAATAAAAATAT
JMSF026C20+ GATCATTCACGAAATGAGAACAGAAATTAAGAGTAGCAATACTGAAGGAAATAAAAATAT
                      ____________________________________________________________
consensus GATCATTCACGAAATGAGAACAGAAATTAAGAGTAGCAATACTGAAGGAAATAAAAATAT
 
. : . : . : . : . : . :
JMFF038M04+ CATAGGTCACATCGATATGCATCAAGAACTTCAAGAGATTACCAAAAACAACTGAATAGC
JMFF022P20+ CATAGGTCACATCGATATGCATCAAGAACTTCAAGAGATTACCAAAAACAACTGAATAGC
JMSF026C20+ CATAGGTCACATCGATATGCATCAAGAACTTCAAGAGATTACCAAAAACAACTGAATAGC
                      ____________________________________________________________
consensus CATAGGTCACATCGATATGCATCAAGAACTTCAAGAGATTACCAAAAACAACTGAATAGC
 
. : . : . : . : . : . :
JMFF038M04+ TGCTGTTAAGGATGTCGCCGCAGCTGCCACCACCAACGGGGCAAAAGGCATCAGACTCCG
JMFF022P20+ TGCTGTTAAGGATGTCGCCGCAGCTGCCACCACCAACGGGGCAAAAGGCATCAGACTCCG
JMSF026C20+ TGCTGTTAAGGATGTCGCCGCAGCTGCCACCGCCAACGGGGCAAAAGGCATCAGACTCCG
                      ____________________________________________________________
consensus TGCTGTTAAGGATGTCGCCGCAGCTGCCACCACCAACGGGGCAAAAGGCATCAGACTCCG
 
. : . : . : . : . : . :
JMFF038M04+ TGAGTTTGAGGTACGTCAAGTACGAAGTTTCCAGGAATCCGATGCCTCCCAGGGCTGCAC
JMSF019E02+ CCAGGAATCCGATGCCTCCCAGGGCTGCAC
JMFF022P20+ TGAGTTTGAGGTACGTCAAGTACGAAGTTTCCAGGAATCCGATGCCTCCCAGGGCTGCAC
JMSF026C20+ TGAGTTTGAGGTACGTCAAGTACGAAGTTTCCAGGAATCCGATGCCTCCCAGGGCTGCAC
                      ____________________________________________________________
consensus TGAGTTTGAGGTACGTCAAGTACGAAGTTTCCAGGAATCCGATGCCTCCCAGGGCTGCAC
 
. : . : . : . : . : . :
JMFF038M04+ ACCAATTGTATGCTGAAATGCTCGAACCACTGCTAGTAGAAGGAGACGACAACTCCTCCG
JMSF019E02+ ACCAATTGTATGCTGAAATGCTCGAACCACTGCTAGTAGAAGGAGACGACAACTCCTCCG
JMFF022P20+ ACCAATTGTATGCTGAAATGCTCGAACCACTGCTAGTAGAAGGAGACGACAACTCCTCCG
JMSF026C20+ ACCAATTGTATGCTGAAATGCTCGAACCACTGCTAGTAGAAGGAGACGACAACTCCTCCG
                      ____________________________________________________________
consensus ACCAATTGTATGCTGAAATGCTCGAACCACTGCTAGTAGAAGGAGACGACAACTCCTCCG
 
. : . : . : . : . : . :
JMFF038M04+ TCTTGGATTCTTTCTCCGCGTCTGTAACTTGCTCCGACGAGCAGTGCACTCGAAGCATCA
JMSF019E02+ TCTTGGATTCTTTCTCCGCGTCTGTAACTTGCTCCGACGAGCAGTGCACTCGAAGCATCA
JMFF022P20+ TCTTGGATTCTTTCTCCGCGTCTGTAACTTGCTCCGACGAGCAGTGCACTCGAAGCATCA
JMSF026C20+ TCTTGGATTCTTTCTCCGCGTCTGTAACTTGCTCCGACGAGCAGTGCACTCGAAGCATCA
                      ____________________________________________________________
consensus TCTTGGATTCTTTCTCCGCGTCTGTAACTTGCTCCGACGAGCAGTGCACTCGAAGCATCA
 
. : . : . : . : . : . :
JMFF038M04+ GCAATTGCCGATCGCGACCGCTCTTGAGTTGTAAGGGAATAGATAGTGAATTGGAACGAG
JMSF019E02+ GCAATTGCCGATCGCGACCGCTCTTGAGTTGTAAGGGAATAGATAGTGAATTGGAACGAG
JMFF022P20+ GCAATTGCCGATCGCGACCGCTCTTGAGTTGTAAGGGAATAGATAGTGAATTGGAACGAG
JMSF026C20+ GCAATTGCCGATCGCGACCGCTCTTGAGTTGTAAGGGAATAGATAGTGAATTGGAACGAG
                      ____________________________________________________________
consensus GCAATTGCCGATCGCGACCGCTCTTGAGTTGTAAGGGAATAGATAGTGAATTGGAACGAG
 
. : . : . : . : . : . :
JMFF038M04+ AGGAGAAGAGAAGAGATGAGTGGTTGAATAGTGGGGAAGACGAGACGCCGATGAGACTCG
JMSF019E02+ AGGAGAAGAGAAGAGATGAGTGGTTGAATAGTGGGGAAGACGAGACGCCGATGAGACTCG
JMFF022P20+ AGGAGAAGAGAAGAGATGAGTGGTTGAATAGTGGGGAAGACGAGACGCCGATGAGACTCG
JMSF026C20+ AGGAGAAGAGAAGAGATGAGTGGTTGAATAGTGGGGAAGACGAGACGCCGATGAGACTCG
                      ____________________________________________________________
consensus AGGAGAAGAGAAGAGATGAGTGGTTGAATAGTGGGGAAGACGAGACGCCGATGAGACTCG
 
. : . : . : . : . : . :
JMFF038M04+ CCATCAGCTCCTCCGTCGAGCGGTGGCGGGGGTGGTTTGACTAGATTTATTGGCGGTGGA
JMSF019E02+ CCATCAGCTCCTCCGTCGAGCGGTGGCGGGGGTGGTTTGACT
JMFF022P20+ CCATCAGCTCCTCCGTCGAGCGGTGGCGGGGGTGGTTTGACTAGATTTATTGGCGGTGGA
JMSF026C20+ CCATCAGCTCCTCCGTCGAGCGGTGGCGGGGGTGGTTTGACTAGATTTATTGGCGGTGGA
                      ____________________________________________________________
consensus CCATCAGCTCCTCCGTCGAGCGGTGGCGGGGGTGGTTTGACTAGATTTATTGGCGGTGGA
 
. : . : . : . : . : . :
JMFF038M04+ AGAGCGGAATTTGACTGATTTGTT
JMFF022P20+ AGAGCGGAATTTGACTGATTTGTT
JMSF026C20+ AGAGCGGAATTTGACTGATTTGTTGAAAGATTTATTTTTGGAGTTTTGGTTTAGTAACCC
                      ____________________________________________________________
consensus AGAGCGGAATTTGACTGATTTGTTGAAAGATTTATTTTTGGAGTTTTGGTTTAGTAACCC