Previous Contig 006352:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS003B08Sequence577006352 (3)pir|G96698|G966982e-42hypothetical protein F12B7.8 [imported] - Arabidopsis thaliana>gb:AE005173_89437
JMSF019I09Sequence578006352 (3)pir|G96698|G966984e-33hypothetical protein F12B7.8 [imported] - Arabidopsis thaliana>gb:AE005173_89437736012086 (2)pir|D86404|D864042e-58unknown protein [imported] - Arabidopsis thaliana>gb:AE005172_891674 Arabidopsis
JMSF026C03Sequence633006352 (3)pir|G96698|G966982e-40hypothetical protein F12B7.8 [imported] - Arabidopsis thaliana>gb:AE005173_89437767012086 (2)pir|D86404|D864043e-57unknown protein [imported] - Arabidopsis thaliana>gb:AE005172_891674 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS003B08+ ATCCC
                      ____________________________________________________________
consensus ATCCC
 
. : . : . : . : . : . :
JMFS003B08+ CTGAAGTTCACTTAGAATTGAAGAAATCTGACAACCAATGGTTTGTGGAACTATATCTTC
JMSF026C03+ CTGACANCCAATGGTTTGTGGAACTATATCTTC
                      ____________________________________________________________
consensus CTGAAGTTCACTTAGAATTGAAGAAATCTGACAACCAATGGTTTGTGGAACTATATCTTC
 
. : . : . : . : . : . :
JMFS003B08+ AACCCGATTTAGACCATCTTGAAGAGCACATCTTGATCTCTCAAATTTAAGTACAATAGA
JMSF019I09+ GAAGAGCACATCTTGATCTCTCAAATTTAAGTACAATAGA
JMSF026C03+ AACCCGATTTAGACCATCTTGAAGAGCACATCTTGATCTCTCAAATTTAAGTACAATAGA
                      ____________________________________________________________
consensus AACCCGATTTAGACCATCTTGAAGAGCACATCTTGATCTCTCAAATTTAAGTACAATAGA
 
. : . : . : . : . : . :
JMFS003B08+ GTCTCCAGTTATTGCCAGGTATAGTTTACTGCATTCAGCACAGTGCTGAAGAATATTCTT
JMSF019I09+ GTCTCCAGTTATTGCCAGGTATAGTTTACTGCATTCAGCACAGTGCTGAAGAATATTCTT
JMSF026C03+ GTCTCCAGTTATTGCCAGGTATAGTTTACTGCATTCAGCACAGTGCTGAAGAATATTCTT
                      ____________________________________________________________
consensus GTCTCCAGTTATTGCCAGGTATAGTTTACTGCATTCAGCACAGTGCTGAAGAATATTCTT
 
. : . : . : . : . : . :
JMFS003B08+ TGTCTTCTCAAGGGCTATATGCAGAGCACACAATGCCTGAATACCTGTAGTGCTTCTTGG
JMSF019I09+ TGTCTTCTCAAGGGCTATATGCAGAGCACACAATGCCTGAATACCTGTAGTGCTTCTTGG
JMSF026C03+ TGTCTTCTCAAGGGCTATATGCAGAGCACACAATGCCTGAATACCTGTAGTGCTTCTTGG
                      ____________________________________________________________
consensus TGTCTTCTCAAGGGCTATATGCAGAGCACACAATGCCTGAATACCTGTAGTGCTTCTTGG
 
. : . : . : . : . : . :
JMFS003B08+ TCGAGCCGCTTCCAGTTCAGGAAAAATTCCCAACACTTTTGCATAGATGGCAGATAGACT
JMSF019I09+ TCGAGCCGCTTCCAGTTCAGGAAAAATTCCCAACACTTTTGCATAGATGGCAGATAGACT
JMSF026C03+ TCGAGCCGCTTCCAGTTCAGGAAAAATTCCCAACACTTTTGCATAGATGGCAGATAGACT
                      ____________________________________________________________
consensus TCGAGCCGCTTCCAGTTCAGGAAAAATTCCCAACACTTTTGCATAGATGGCAGATAGACT
 
. : . : . : . : . : . :
JMFS003B08+ CTTGCACATTCCTCCATGTAGCTTAGGTTCACCAATTGAGCATAAATTTTCTTCAACCTC
JMSF019I09+ CTTGCACATTCCTCCATGTAGCTTAGGTTCACCAATTGAGCATAAATTTTCTTCAACCTC
JMSF026C03+ CTTGCACATTCCTCCATGTAGCTTAGGTTCACCAATTGAGCATAAATTTTCTTCAACCTC
                      ____________________________________________________________
consensus CTTGCACATTCCTCCATGTAGCTTAGGTTCACCAATTGAGCATAAATTTTCTTCAACCTC
 
. : . : . : . : . : . :
JMFS003B08+ AGAATTATCCATTATTTCACATTTAACACAGAAAAGAACAATCCTGCCGCTTATTATCGA
JMSF019I09+ AGAATTATCCATTATTTCACATTTAACACAGAAAAGAACAATCCTGCCGCTTATTATCGA
JMSF026C03+ AGAATTATCCATTATTTCACATTTAACACAGAAAAGAACAATCCTGCCGCTTATTATCGA
                      ____________________________________________________________
consensus AGAATTATCCATTATTTCACATTTAACACAGAAAAGAACAATCCTGCCGCTTATTATCGA
 
. : . : . : . : . : . :
JMFS003B08+ AATAAACAGAACAGCATCAAAGCAGGCTTCATCAACGAAGCACTAAGACAGTAATGTGTG
JMSF019I09+ AATAAACAGAACAGCATCAAAGGAGGCTTCATCAACGAAGCACTAAGACAGTAATGTGTG
JMSF026C03+ AATAAACAGAACAGCATCAAAGGAGGCTTCATCAACGAAGCACTAAGACAGTAATGTGTG
                      ____________________________________________________________
consensus AATAAACAGAACAGCATCAAAGGAGGCTTCATCAACGAAGCACTAAGACAGTAATGTGTG
 
. : . : . : . : . : . :
JMFS003B08+ GTCGCAGTAGATAATATTCGAATATATATACATGTATTGCTAATATAGATATACGACGGA
JMSF019I09+ GTCGCAGTAGATAATATTCGAATATATATACATGTATTGCTAATATAGATATACGACGGA
JMSF026C03+ GTCGCAGTAGATAATATTCGAATATATATACATGTATTGCTAATATAGATATACGACGGA
                      ____________________________________________________________
consensus GTCGCAGTAGATAATATTCGAATATATATACATGTATTGCTAATATAGATATACGACGGA
 
. : . : . : . : . : . :
JMFS003B08+ GCTCAGTATTCAGATCAAGAGATTTTTAGAGA
JMSF019I09+ GCTCAGTATTCAGATCAAGAGATTTTTAGAGAGAGAAAACTGGGACGCAGGAGAGAGAGA
JMSF026C03+ GCTCAGTATTCAGATCAAGAGATTTTTAGAGAGAGAAAACTGGGACGCAGGAGAGAGAGA
                      ____________________________________________________________
consensus GCTCAGTATTCAGATCAAGAGATTTTTAGAGAGAGAAAACTGGGACGCAGGAGAGAGAGA
 
. : . : . : . : . : . :
JMSF019I09+ GAGAGAGAGAAGAAGAGTGCTTTTTCAGGGTTATTAAAGAAGAGAGGATGAAGGAAT
JMSF026C03+ GAGAGAGAGAAGAAGAGTGCTTTTTCAGGGTTATTAAAGAAGAGAGGATGAAGGAATAGC
                      ____________________________________________________________
consensus GAGAGAGAGAAGAAGAGTGCTTTTTCAGGGTTATTAAAGAAGAGAGGATGAAGGAATAGC