Previous Contig 006347:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019K24Sequence347006347 (9)234011748 (5)gb:BT008315_16395323e-27Arabidopsis thaliana At1g52730 gene, complete cds.>gb:F6D8_1678452 Arabidopsis t
JMSF002H03Sequence338006347 (9)
JMSF013J01Sequence348006347 (9)322011748 (5)gb:AB017071_15134861e-43Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:BT002047_163
JMSF013J09Sequence350006347 (9)603011748 (5)gb:AB017071_15134863e-66Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:BT002047_163
JMSF016L11Sequence348006347 (9)302006347 (9)
JMSF018J08Sequence231006347 (9)347011748 (5)gb:AP005008_18472255e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P054
JMSF026A20Sequence347006347 (9)566011748 (5)gb:AB017071_15134861e-64Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:BT002047_163
JMSF042G21Sequence347006347 (9)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019K24+ ATATATACGGAACAACAATGAAAAATCTCGATTAGAAAT
JMSF042G21+ TTTTTTTTTTATATATACGGAACAACAATGAAAAATCTCGATTAGAAAT
JMSF016L11+ TTTTTTTTTTATATATACGGAACAACAATGAAAAATCTCGATTAGAAAT
JMSF002H03+ ATATACGGAACAACAATGAAAAATCTCGATTAGAAAT
JMSF013J09+ ATATACGGAACAACAATGAAAAATCTCGATTAGAAAT
rJMSF016L11- AAT
JMSF013J01+ TTTTTTTNTNATATATGCGGAACAACAATGAAAAATCTCGATTAGAAAT
JMSF026A20+ TTTTTTTTTNATATATACGGAACAACAATGAAAAATCTCGATTAGAAAT
                      ____________________________________________________________
consensus TTTTTTTTTTATATATACGGAACAACAATGAAAAATCTCGATTAGAAAT
 
. : . : . : . : . : . :
JMFF019K24+ TTCCGAAGAAAAAAACTGAAAATTTTCTGCGGATTAGATATAGATATAGAAATAGAAATA
JMSF042G21+ TTCCGAAGAAAAAAACTGAAAATTTTCTGCGGATTAGGTATAGATATAGAAATAGAAATA
JMSF016L11+ TTCCGAAGAAAAAAACTGAAAATTTTCTGCGGATTAGATATAGATATAGAAATAGAAATA
JMSF002H03+ TTCCGAAGAAAAAAACTGAAAATTTTCTGCGGATTAGATATAGATATAGAAATAGAAATA
JMSF013J09+ TTCCGAAGAAAAAAACTGAAAATTTTCTGCGGATTAGATATAGATATAGAAATAGAAATA
rJMSF016L11- TTCCGAAGAAAAAAACTGAAAATTTTCTGCGGATTAGATATAGATATAGAAATAGAAATA
JMSF013J01+ TTCCGAAGAAAAAAACTGAAAATTTTCTGCGGATTAGATATAGATATAGAAATAGAAATA
JMSF026A20+ TTCCGAAGAAAAAAACTGAAAATTTTCTGCGGATTAGATATAGATATAGAAATAGAAATA
                      ____________________________________________________________
consensus TTCCGAAGAAAAAAACTGAAAATTTTCTGCGGATTAGATATAGATATAGAAATAGAAATA
 
. : . : . : . : . : . :
JMFF019K24+ TATGTATCTGCCTATAATAAAGTGTATATATTACGGGAAATGGCGCGACCGATTATCAAA
JMSF042G21+ TATGTATCTGCCTATAATAAAGTGTATATATTACGGGAAATGGCGCGACCGATTATCAAA
JMSF016L11+ TATGTATCTGCCTATAATAAAGTGTATATATTACGGGAAATGGCGCGACCGATTATCAAA
JMSF002H03+ TATGTATCTGCCTATAATAAAGTGTATATATTACGGGAAATGGCGCGACCGATTATCAAA
JMSF013J09+ TATGTATCTGCCTATAATAAAGTGTATATATTACGGGAAATGGCGCGACCGATTATCAAA
rJMSF016L11- TATGTATCTGCCTATAATAAAGTGTATATATTACGGGAAATGGCGCGACCGATTATCAAA
JMSF018J08+ TGCCTATAATAAAGTGTATATATTACGGGAAATGGCGCGACCGATTATCAAA
JMSF013J01+ TATGTATCTGCCTATAATAAAGTGTATATATTACGGGAAATGGCGCGACCGATTATCAAA
JMSF026A20+ TATGTATCTGCCTATAATAAAGTGTATATATTA-GGGAAATGGCGCGACCGATTATCAAA
                      ____________________________________________________________
consensus TATGTATCTGCCTATAATAAAGTGTATATATTACGGGAAATGGCGCGACCGATTATCAAA
 
. : . : . : . : . : . :
JMFF019K24+ GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
JMSF042G21+ GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
JMSF016L11+ GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
JMSF002H03+ GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
JMSF013J09+ GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
rJMSF016L11- GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
JMSF018J08+ GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
JMSF013J01+ GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
JMSF026A20+ GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
                      ____________________________________________________________
consensus GGCGGGAAACCCTAATCTGAGATTGACAGGTTTGATTCCTTAACGAATCCACACCTCCAG
 
. : . : . : . : . : . :
JMFF019K24+ CTCAAGACGATGGATAGATCAGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
JMSF042G21+ CTCAAGACGATGGATAGATCAGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
JMSF016L11+ CTCAAGACGATGGATAGATCAGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
JMSF002H03+ CTCAAGACGATGGATAGATCAGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
JMSF013J09+ CTCAAGACGATGGATAGATCNGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
rJMSF016L11- CTCAAGACGATGGATAGATCAGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
JMSF018J08+ CTCAAGACGATGGATAGATCAGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
JMSF013J01+ CTCAAGACGATGGATAGATCAGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
JMSF026A20+ CTCAAGACGATGGATAGATCAGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
                      ____________________________________________________________
consensus CTCAAGACGATGGATAGATCAGTAGTGATTATTGCAATTATTCGTAAAATCAGAGAAAAA
 
. : . : . : . : . : . :
JMFF019K24+ AAATTAAAAAGAAAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGC
JMSF042G21+ AAATTAAAAAG-AAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGCC
JMSF016L11+ AAATTAAAAAGAAAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGCC
JMSF002H03+ AAATTAAAAAGAAAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGC
JMSF013J09+ AAATTAAAAAGAAAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGC
rJMSF016L11- AAATTAAAAAGAAAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGCC
JMSF018J08+ AAATTAAAAAGAAAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGCC
JMSF013J01+ AAATTAAAAAGAAAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGCC
JMSF026A20+ AAATTAAAAAG-AAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGCCA
                      ____________________________________________________________
consensus AAATTAAAAAGAAAAAAAAAGAAATATAAAATCCAAAACTACACTACGAGCTGGGCGCCA