Previous Contig 006341:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018G13Sequence574006341 (5)gb:AP003884_18348157e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11659009062 (5)gb:AP003884_18348158e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFF040B05Sequence583006341 (5)gb:AP003884_18348151e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11755009062 (5)gb:AP003884_18348158e-73Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMSF011C14Sequence298006341 (5)704009062 (5)gb:AP003884_18348154e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMSF025P17Sequence618006341 (5)gb:AP003884_18348151e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11752009062 (5)gb:AP003884_18348151e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMSF026A21Sequence634006341 (5)gb:AP003884_18348159e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11647009062 (5)gb:AP003884_18348153e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018G13+ AGATTTTTCCGATCACGTATTCTTTCCGCAGTTGAAGAG
JMSF026A21+ AAGAG
                      ____________________________________________________________
consensus AGATTTTTCCGATCACGTATTCTTTCCGCAGTTGAAGAG
 
. : . : . : . : . : . :
JMFF018G13+ GAATCATCAGAAATGTGGTCAGATTTCACTGAATTGTTCCCTTCTTCAGTCACCTGTCTT
JMSF026A21+ GAATCATCAGAAATGTGGTCAGATTTCACTGAATTGTTCCCTTCTTCAGTCACCTGTCTT
JMFF040B05+ TCTT
JMSF025P17+ TCTTCAGTCACCTGTCTT
                      ____________________________________________________________
consensus GAATCATCAGAAATGTGGTCAGATTTCACTGAATTGTTCCCTTCTTCAGTCACCTGTCTT
 
. : . : . : . : . : . :
JMFF018G13+ AAGGGATCATCATCAACAGCTCTCCCAGTTTCCTGATCCCTGCCCTTAGTGGATACATTG
JMSF026A21+ AAGGGATCATCATCAACAGCTCTCCCAGTTTCCTGATCCCTGCCCTTAGTGGATACATTG
JMFF040B05+ AAGGGATCATCATCAACAGCTCTCCCAGTTTCCTGATCCCTGCCCTTAGTGGATACATTG
JMSF025P17+ AAGGGATCATCATCAACAGCTCTCCCAGTTTCCTGATCCCTGCCCTTAGTGGATACATTG
                      ____________________________________________________________
consensus AAGGGATCATCATCAACAGCTCTCCCAGTTTCCTGATCCCTGCCCTTAGTGGATACATTG
 
. : . : . : . : . : . :
JMFF018G13+ CCCATTTCATTTTCTTCTGCAAGTTGTCTGGTTTTTCTGGCACTTTCATTCCTCTGACCA
JMSF026A21+ CCCATTTCATTTTCTTCTGCAAGTTGTCTGGTTTTTCTGGCACTTTCATTCCTCTGACCA
JMFF040B05+ CCCATTTCATTTTCTTCTGCAAGTTGTCTGGTTTTTCTGGCACTTTCATTCCTCTGACCA
JMSF025P17+ CCCATTTCATTTTCTTCTGCAAGTTGTCTGGTTTTTCTGGCACTTTCATTCCTCTGACCA
                      ____________________________________________________________
consensus CCCATTTCATTTTCTTCTGCAAGTTGTCTGGTTTTTCTGGCACTTTCATTCCTCTGACCA
 
. : . : . : . : . : . :
JMFF018G13+ TCCGAGGCTTCGGAATGGGATAATATTGAATTCTCAGAATACACTACGCCCAATGGTTCT
JMSF026A21+ TCCGAGGCTTCGGAATGGGATAATATTGAATTCTCAGAATACACTACGCCCAATGGTTCT
JMFF040B05+ TCCGAGGCTTCGGAATGGGATAATATTGAATTCTCAGAATACACTACGCCCAATGGTTCT
JMSF025P17+ TCCGAGGCTTCGGAATGGGATAATATTGAATTCTCAGAATACACTACGCCCAATGGTTCT
                      ____________________________________________________________
consensus TCCGAGGCTTCGGAATGGGATAATATTGAATTCTCAGAATACACTACGCCCAATGGTTCT
 
. : . : . : . : . : . :
JMFF018G13+ TTCGTGATTGTATTTGGCTCCTGCGGTAGCACATTTAATGGCCGGATTTCGCCACCCAAT
JMSF026A21+ TTCGTGATTGTATTTGGCTCCTGCGGTAGCACATTTAATGGCCGGATTTCGCCACCCAAT
JMFF040B05+ TTCGTGATTGTATTTGGCTCCTGCGGTAGCACATTTAATGGCCGGATTTCGCCACCCAAT
JMSF025P17+ TTCGTGATTGTATTTGGCTCCTGCGGTAGCACATTTAATGGCCGGATTTCGCCACCCAAT
                      ____________________________________________________________
consensus TTCGTGATTGTATTTGGCTCCTGCGGTAGCACATTTAATGGCCGGATTTCGCCACCCAAT
 
. : . : . : . : . : . :
JMFF018G13+ GTAAAAGCGGATACTTCTTCAATGAATTCGTCTCTAGAAGGAGAGGAATTGAATCGAGTG
JMSF026A21+ GTAAAAGCGGATACTTCTTCAATGAATTCGTCTCTAGAAGGAGAGGAATTGAATCGAGTG
JMSF011C14+ CTCTAGAAGGAGAGGAATTGAATCGAGTG
JMFF040B05+ GTAAAAGCGGATACTTCTTCAATGAATTCGTCTCTAGAAGGAGAGGAATTGAATCGAGTG
JMSF025P17+ GTAAAAGCGGATACTTCTTCAATGAATTCGTCTCTAGAAGGAGAGGAATTGAATCGAGTG
                      ____________________________________________________________
consensus GTAAAAGCGGATACTTCTTCAATGAATTCGTCTCTAGAAGGAGAGGAATTGAATCGAGTG
 
. : . : . : . : . : . :
JMFF018G13+ TCAGTGTAGAGCACAATGGGGGCAAGAACCGTCACCAACAACAAGAACAACACTGACTTC
JMSF026A21+ TCAGTGTAGAGCACAATGGGGGCAAGAACCGTCACCAACAACAAGAACAACACTGACTTC
JMSF011C14+ TCAGTGTAGAGCACAATGGGGGCAAGAACCGTCACCAACAACAAGAACAACACTGACTTC
JMFF040B05+ TCAGTGTAGAGCACAATGGGGGCAAGAACCGTCACCAACAACAAGAACAACACTGACTTC
JMSF025P17+ TCAGTGTAGAGCACAATGGGGGCAAGAACCGTCACCAACAACAAGAACAACACTGACTTC
                      ____________________________________________________________
consensus TCAGTGTAGAGCACAATGGGGGCAAGAACCGTCACCAACAACAAGAACAACACTGACTTC
 
. : . : . : . : . : . :
JMFF018G13+ CTTCTAAACCTCATCTCTCCCTGCTCTAAAACCTGAAAAAACTTTACCCTTTTCTTCACT
JMSF026A21+ CTTCTAAACCTCATCTCTCCCTGCTCTAAAACCTGAAAAAACTTTACCCTTTTCTTCACT
JMSF011C14+ CTTCTAAACCTCATCTCTCCCTGCTCTAAAACCTGAAAAAACTTTACCCTTTTCTTCACT
JMFF040B05+ CTTCTAAACCTCATCTCTCCCTGCTCTAAAACCTGAAAAAACTTTACCCTTTTCTTCACT
JMSF025P17+ CTTCTAAACCTCATCTCTCCCTGCTCTAAAACCTGAAAAAACTTTACCCTTTTCTTCACT
                      ____________________________________________________________
consensus CTTCTAAACCTCATCTCTCCCTGCTCTAAAACCTGAAAAAACTTTACCCTTTTCTTCACT
 
. : . : . : . : . : . :
JMFF018G13+ TCCCAGAGTCAAAACCCAATCAAGATCATAGCCAATAGGAGAACCTGTCAAACCC
JMSF026A21+ TCCCAGAGTCAAAACCCAATCAAGATCATAGCCAATAGGAGAACCTGTCAAACCCAAACT
JMSF011C14+ TCCCAGAGTCAAAACCCAATCAAGATCATAGCCAATAGGAGAACCTGTCAAACCCAAACT
JMFF040B05+ TCCCAGAGTCAAAACCCAATCAAGATCATAGCCAATAGGAGAACCTGTCAAACCCAAACT
JMSF025P17+ TCCCAGAGTCAAAACCCAATCAAGATCATAGCCAATAGGAGAACCTGTCAAACCCAAACT
                      ____________________________________________________________
consensus TCCCAGAGTCAAAACCCAATCAAGATCATAGCCAATAGGAGAACCTGTCAAACCCAAACT
 
. : . : . : . : . : . :
JMSF026A21+ GGAAAATGAGAAAATCTGTGTTTTGTTACCTCTCCCTTTGGGAGGAGTGACAGAGACAGA
JMSF011C14+ GGAAAATGAGAAAATCTGTGTTTTGTTACCTCTCCCTTTGGGAGGAGTGACAGAGACAGA
JMFF040B05+ GGAAAATGAGAAAATCTGTGTTTTGTTACCTCTCCCTTTGGGAGGAGTGACAGAGACAGA
JMSF025P17+ GGAAAATGAGAAAATCTGTGTTTTGTTACCTCTCCCTTTGGGAGGAGTGACAGAGACAGA
                      ____________________________________________________________
consensus GGAAAATGAGAAAATCTGTGTTTTGTTACCTCTCCCTTTGGGAGGAGTGACAGAGACAGA
 
. : . : . : . : . : . :
JMSF026A21+ GAGTATGATGTCCGTGTCGGCAAACCGT
JMSF011C14+ GAGTATGATGTCCGTGTCGGCAAACCGT
JMFF040B05+ GAGTATGATGTCCGTGTCGGCAAACCGTAACGACTAATT
JMSF025P17+ GAGTATGATGTCCGTGTCGGCAAACCGTAACGACTAATTGCGTGAAAAAGTGTGATAGCC
                      ____________________________________________________________
consensus GAGTATGATGTCCGTGTCGGCAAACCGTAACGACTAATTGCGTGAAAAAGTGTGATAGCC