Previous Contig 006338:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K05Sequence520006338 (11)gb:AY057723_15641352e-47Arabidopsis thaliana AT5g10730/MAJ23_90 mRNA, complete cds.>gb:AY081321_1568667 779006338 (11)gb:AP004017_18364311e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF046H21Sequence557006338 (11)gb:AY057723_15641352e-54Arabidopsis thaliana AT5g10730/MAJ23_90 mRNA, complete cds.>gb:AY081321_1568667 401006338 (11)gb:AY057723_15641352e-05Arabidopsis thaliana AT5g10730/MAJ23_90 mRNA, complete cds.>gb:AY081321_1568667
JMFN010I10Sequence624006338 (11)gb:AY057723_15641356e-67Arabidopsis thaliana AT5g10730/MAJ23_90 mRNA, complete cds.>gb:AY081321_1568667
JMSF012K06Sequence511006338 (11)gb:AY057723_15641352e-47Arabidopsis thaliana AT5g10730/MAJ23_90 mRNA, complete cds.>gb:AY081321_1568667 725006338 (11)gb:AY057723_15641352e-73Arabidopsis thaliana AT5g10730/MAJ23_90 mRNA, complete cds.>gb:AY081321_1568667
JMSF025P11Sequence707006338 (11)gb:AY057723_15641357e-73Arabidopsis thaliana AT5g10730/MAJ23_90 mRNA, complete cds.>gb:AY081321_1568667 726006338 (11)gb:AP004017_18364313e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMSF039O17Sequence683006338 (11)gb:AY057723_15641355e-76Arabidopsis thaliana AT5g10730/MAJ23_90 mRNA, complete cds.>gb:AY081321_1568667 791006338 (11)gb:AY057723_15641353e-60Arabidopsis thaliana AT5g10730/MAJ23_90 mRNA, complete cds.>gb:AY081321_1568667

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046H21- CTTTTTTTTTTTTTTTTTGAT
rJMSF025P11- TGAT
rJMFF005K05- TGAT
                      ____________________________________________________________
consensus CTTTTTTTTTTTTTTTTTGAT
 
. : . : . : . : . : . :
rJMFF046H21- AGTAACATACATTTTTCCACCG-TTTAAAAATGTGTCCAAATACATCTACCTGGTTTTAA
rJMSF025P11- AGTAACATACATTTTTCCACCGTTTTAGAAATGTGTCCAAATACATCTACCTGGTTTTAG
rJMFF005K05- AGTAACATACATTTTTCCACCG-TTTAGAAATGTGTCCAAATACATCTACCTGGTTTTAG
rJMSF039O17- AATACATCTACCTGGTTTTAG
                      ____________________________________________________________
consensus AGTAACATACATTTTTCCACCG-TTTAGAAATGTGTCCAAATACATCTACCTGGTTTTAG
 
. : . : . : . : . : . :
rJMFF046H21- AGTGCTGCGATATGCACTGCACTCCCATCTCACTGCCTCACCACCTTTACATGTTTTTCC
rJMSF025P11- AGTGCTGCGATATGCACTGCACTCCCATCTCACTGCCTCACCACCTTTACATGTTTTTCC
rJMFF005K05- AGTGCTGCGATATGCACTGCACTCCCATCTCACTGCCTCACCACCTTTACATGTTTTTCC
rJMSF039O17- AGTGCTGCGATATGCACTGCACTCCCATCTCACTGCCTCACCACCTTTACATGTTTTTCC
                      ____________________________________________________________
consensus AGTGCTGCGATATGCACTGCACTCCCATCTCACTGCCTCACCACCTTTACATGTTTTTCC
 
. : . : . : . : . : . :
rJMFF046H21- TAAACAAAAGAATGAGACCACTTATTGCCAAGTTAGATGTATTTATTTGTGTGTGAATGA
rJMSF025P11- TAAACAAAAGAATGAGACCACTTATTGCCAAGTTAGATGTATTTATTTGTGTGTGAATGA
rJMFF005K05- TAAACAAAAGAATGAGACCACTTATTGCCAAGTTAGATGTATTTATTTGTGTGTGAATGA
rJMSF039O17- TAAACAAAAGAATGAGACCACTTATTGCCAAGTTAGATGTATTTATTTGTGTGTGAATGA
                      ____________________________________________________________
consensus TAAACAAAAGAATGAGACCACTTATTGCCAAGTTAGATGTATTTATTTGTGTGTGAATGA
 
. : . : . : . : . : . :
rJMFF046H21- CCTTTTCCATAAAAATCCAACTTCTTATTGAATTTACAAATGCTACACTGAAAATGAAAA
rJMSF025P11- CCTTTTCCATAGAAATCCAACTTCTTATTGAATTTACAAATGCTACACTGAAAATGAAAA
rJMFF005K05- CCTTTTCCATAGAAATCCAACTTCTTATTGAATTTACAAATGCTACACTGAAAATGAAAA
rJMSF039O17- CCTTTTCCATAGAAATCCAACTTCTTATTGAATTTACAAATGCTACACTGAAAATGAAAA
rJMSF012K06- AACTTCTTATTGAATTTACAAATGCTACACTGAAAATGAAAA
                      ____________________________________________________________
consensus CCTTTTCCATAGAAATCCAACTTCTTATTGAATTTACAAATGCTACACTGAAAATGAAAA
 
. : . : . : . : . : . :
rJMFF046H21- GGCAAAAGAGGG-AAAAAAAGAAAGAGAATGGCTGTTGGCGCGGGAACTACTTGGCAAAA
rJMSF025P11- GGCAAAAGAGGGAAAAAAAAGAAAGAGAATGGCTGTTGGCGCGGGAACTACTTGGCAAAA
rJMFF005K05- GGCAAAAGAGGG-AAAAAAAGAAAGAGAATGGCTGTTGGCGCGGGAACTACTTGGCAAAA
rJMSF039O17- GGCAAAAGAGGG-AAAAAAAGAAAGAGAATGGCTGTTGGCGCGGGAACTACTTGGCAAAA
rJMSF012K06- GGCAAAAGAGGG-AAAAAAAGAAAGAGAATGGCTGTTGGCGCGGGAACTACTTGGCAAAA
                      ____________________________________________________________
consensus GGCAAAAGAGGG-AAAAAAAGAAAGAGAATGGCTGTTGGCGCGGGAACTACTTGGCAAAA
 
. : . : . : . : . : . :
rJMFF046H21- AGCTCATCTATACAGACTTCTGTTGACTGTAGCGTAATATCCCATGGACATCGACGATTC
rJMSF025P11- AGCTCATCTATACAGACTTCTGTTGACTGTAGCGTAATATCCCATGGACATCGACGATTC
rJMFF005K05- AGCTCATCTATACAGACTTCTGTTGACTGTAGCGTAATATCCCATGGACATCGACGATTC
rJMSF039O17- AGCTCATCTATACAGACTTCTGTTGACTGTAGCGTAATATCCCATGGACATCGACGATTC
rJMSF012K06- AGCTCATCTATACAGACTTCTGTTGACTGTAGCGTAATATCCCATGGACATCGACGATTC
                      ____________________________________________________________
consensus AGCTCATCTATACAGACTTCTGTTGACTGTAGCGTAATATCCCATGGACATCGACGATTC
 
. : . : . : . : . : . :
rJMFF046H21- CAGGAGGGAAAACCGGATCAGT
rJMSF025P11- CAGGAGGGAAAACCGGATCAGTAGCCGCTCTGACAGCTACTTTTGCCACTGAAGTAACAC
rJMFF005K05- CAGGAGGGAAAACCGGATCAGTAGCCGCTCTGACAGCTACTTTTGCCACTGAAGTAACAC
rJMSF039O17- CAGGAGGGAAAACCGGATCAGTAGCCGCTCTGACAGCTACTTTTGCCACTGAAGTAACAC
rJMSF012K06- CAGGAGGGAAAACCGGATCAGTAGCCGCTCTGACAGCTACTTTTGCCACTGAAGTAACAC
                      ____________________________________________________________
consensus CAGGAGGGAAAACCGGATCAGTAGCCGCTCTGACAGCTACTTTTGCCACTGAAGTAACAC
 
. : . : . : . : . : . :
rJMSF025P11- TAACGGGAGGGGTGAGCAAGGGCCCAACAACAGGAAGCTGGCCCAATGGTTTCGCATGTT
rJMFF005K05- TAACGGGAGGGGTGAGCAAGGGCCCAACAACAGGAAGCTGGCCCAATGGTTTCGCATGTT
rJMSF039O17- TAACGGGAGGGGTGAGCAAGGGCCCAACAACAGGAAGCTGGCCCAATGGTTTCGCATGTT
rJMSF012K06- TAACGGGAGGGGTGAGCAAGGGCCCAACAACAGGAAGCTGGCCCAATGGTTTCGCATGTT
                      ____________________________________________________________
consensus TAACGGGAGGGGTGAGCAAGGGCCCAACAACAGGAAGCTGGCCCAATGGTTTCGCATGTT
 
. : . : . : . : . : . :
rJMSF025P11- GGAGAATCATCTCAAGAGGAGAACCAACAAGACCTAGAGGCAATTTCATGCTCCCAACAC
rJMFF005K05- GGAGAATCATCTCAAGAGGAGAACCAACAAGACCTAGAGGCAATTTCATGCTCCCAACAC
rJMSF039O17- GGAGAATCATCTCAAGAGGAGAACCAACAAGACCTAGAGGCAATTTCATGCTCCCAACAC
rJMSF012K06- GGAGAATCATCTCAAGAGGAGAACCAACAAGACCTAGAGGCAATTTCATGCTCCCAACAC
                      ____________________________________________________________
consensus GGAGAATCATCTCAAGAGGAGAACCAACAAGACCTAGAGGCAATTTCATGCTCCCAACAC
 
. : . : . : . : . : . :
rJMSF025P11- GACGGGTTCCATGGATGAATCCAGGTCTCAGAATCACACCTCCATAGGTATATCGGGTCA
rJMFF005K05- GACGGGTTCCATGGATGAATCCAGGTCTCAGAATCACACCTCCATAGGTATATCGGGTCA
rJMSF039O17- GACGGGTTCCATGGATGAATCCAGGTCTCAGAATCACACCTCCATAGGTATATCGGGTCA
rJMSF012K06- GACGGGTTCCATGGATGAATCCAGGTCTCAGAATCACACCTCCATAGGTATATCGGGTCA
JMFN010I10+ TCGGGTCA
JMSF039O17+ GACGGGTTCCATGGATGAATCCAGGTCTCAGAATCACACCTCCATAGGTATATCGGGTCA
JMSF025P11+ GATGAATCCAGGTCTCAGAATCACACCTCCATAGGTATATCGGGTCA
                      ____________________________________________________________
consensus GACGGGTTCCATGGATGAATCCAGGTCTCAGAATCACACCTCCATAGGTATATCGGGTCA
 
. : . : . : . : . : . :
rJMSF025P11- ATAGTTCTGTTTCAGCAGCTCTCTTTCCATCATAATAACATTGTAGTAGGTAATTGACAA
rJMFF005K05- ATAGTTCTGTTTCAGCAGCTCTCTTTCCATCATAATAACCTTGTAGTAGGTAATTGACAA
rJMSF039O17- ATAGTTCTGTTTCAGCAGCTCTCTTTCCATCATAATAACCTTGTAGTAGGTAATTGACAA
rJMSF012K06- ATAGTTCTGTTTCAGCAGCTCTCTTTCCATCATAATAACCTTGTAGTAGGTAATTGACAA
JMFN010I10+ ATAGTTCTGTTTCAGCAGCTCTCTTTCCATCATAATAACCTTGTAGTAGGTAATTGACAA
JMSF039O17+ ATAGTTCTGTTTCAGCAGCTCTCTTTCCATCATAATAACCTTGTAGTAGGTAATTGACAA
JMSF025P11+ ATAGTTCTGTTTCAGCAGCTCTCTTTCCATCATAATAACATTGTAGTAGGTAATTGACAA
                      ____________________________________________________________
consensus ATAGTTCTGTTTCAGCAGCTCTCTTTCCATCATAATAACCTTGTAGTAGGTAATTGACAA
 
. : . : . : . : . : . :
rJMSF025P11- AGCCAAAATCAGCAGCCGAAATGTAAACAAATCTTTTTACTCCTTCTTC
rJMFF005K05- AGCCAAAATCAGCAGCCGAAATGTAAACAAATCTTTTTACTCCTTCTTCAGCAGCAGCTC
rJMSF039O17- AGCCAAAATCAGCAGCCGAAATGTAAACAAATCTTTTTACTCCTTCTTCAGCAGCAGCTC
rJMSF012K06- AGCCAAAATCAGCAGCCGAAATGTAAACAAATCTTTTTACTCCTTCTTCAGCAGCAGCTC
JMSF012K06+ CCTTCTTCAGCAGCAGCTC
JMFN010I10+ AGCCAAAATCAGCAGCCGAAATGTAAACAAATCTTTTTACTCCTTCTTCAGCAGCAGCTC
JMSF039O17+ AGCCAAAATCAGCAGCCGAAATGTAAACAAATCTTTTTACTCCTTCTTCAGCAGCAGCTC
JMFF046H21+ TTCAGCAGCAGCTC
JMFF005K05+ CTTCTTCAGCAGCAGCTC
JMSF025P11+ AGCCAAAATCAGCAGCCGAAATGTAAACAAATCTTTTTACTCCTTCTTCAGCAGCAGCTC
                      ____________________________________________________________
consensus AGCCAAAATCAGCAGCCGAAATGTAAACAAATCTTTTTACTCCTTCTTCAGCAGCAGCTC
 
. : . : . : . : . : . :
rJMFF005K05- TTATAGCATTTATGTTGGCTGTTCCATTGATCTTATACATGTATGA
rJMSF039O17- TTATAGCATTTATGTTGGCTGTTCCATTGATCTTATACATGTATGAGTTAGAGCCAAAGC
rJMSF012K06- TTATAGCATTTATGTTGGCTGTTCCATTGATCTTATACATGTATGAGTTAGAGCCAAAGC
JMSF012K06+ TTATAGCATTTATGTTGGCTGTTCCATTGATCTTATACATGTATGAGTTAGAGCCAAAGC
JMFN010I10+ TTATAGCATTTATGTTGGCTGTTCCATTGATCTTATACATGTATGAGTTAGAGCCAAAGC
JMSF039O17+ TTATAGCATTTATGTTGGCTGTTCCATTGATCTTATACATGTATGAGTTAGAGCCAAAGC
JMFF046H21+ TANTAGCATTTATGTTGGCTGTTCCATNGATCTTATACATGTATGAGTTAGAGCCAAAGC
JMFF005K05+ TTATAGCATTTATGTTGGCTGTTCCATTGATCTTATACATGTATGAGTTAGAGCCAAAGC
JMSF025P11+ TTATAGCATTTATGTTGGCTGTTCCATTGATCTTATACATGTATGAGTTAGAGCCAAAGC
                      ____________________________________________________________
consensus TTATAGCATTTATGTTGGCTGTTCCATTGATCTTATACATGTATGAGTTAGAGCCAAAGC
 
. : . : . : . : . : . :
rJMSF039O17- CGCCTACACAAGATATAACAGAAGCTACTCCTTTAAGTGCTTCCTTCCAGG
rJMSF012K06- CGCCTACACAAGATATAACAGAAGCTACTCCTTTAAGTGCTTCCTTCCAGGAATCATTAG
JMSF012K06+ CGCCTACACAAGATATAACAGAAGCTACTCCTTTAAGTGCTTCCTTCCAGGAATCATTAG
JMFN010I10+ CGCCTACACAAGATATAACAGAAGCTACTCCTTTAAGTGCTTCCTTCCAGGAATCATTAG
JMSF039O17+ CGCCTACACAAGATATAACAGAAGCTACTCCTTTAAGTGCTTCCTTCCAGGAATCATTAG
JMFF046H21+ CGCCTACACAAGATATAACAGAAGCTACTCCTTTAAGTGCTTCCTTCCAGGAATCATTAG
JMFF005K05+ CGCCTACACAAGATATAACAGAAGCTACTCCTTTAAGTGCTTCCTTCCAGGAATCATTAG
JMSF025P11+ CGCCTACACAAGATATAACAGAAGCTACTCCTTTAAGTGCTTCCTTCCAGGAATCATTAG
                      ____________________________________________________________
consensus CGCCTACACAAGATATAACAGAAGCTACTCCTTTAAGTGCTTCCTTCCAGGAATCATTAG
 
. : . : . : . : . : . :
rJMSF012K06- AGAGAAGGTTTCCTTGGTGCCAAGATACATTGTTTGCCCAAGGCTCTGATATGGATGACC
JMSF012K06+ AGAGAAGGTTTCCTTGGTGCCAAGATACATTGTTTGCCCAAGGCTCTGATATGGATGACC
JMFN010I10+ AGAGAAGGTTTCCTTGGTGCCAAGATACATTGTTTGCCCAAGGCTCTGATATGGATGACC
JMSF039O17+ AGAGAAGGTTTCCTTGGTGCCAAGATACATTGTTTGCCCAAGGCTCTGATATGGATGACC
JMFF046H21+ AGAGAAGGTTTCCTTGGTGCCAAGATACATTGTTTGCCCAAGGCTCTGATATGGATGACC
JMFF005K05+ AGAGAAGGTTTCCTTGGTGCCAAGATACATTGTTTGCCCAAGGCTCTGATATGGATGACC
JMSF025P11+ AGAGAAGGTTTCCTTGGTGCCAAGATACATTGTTTGCCCAAGGCTCTGATATGGATGACC
                      ____________________________________________________________
consensus AGAGAAGGTTTCCTTGGTGCCAAGATACATTGTTTGCCCAAGGCTCTGATATGGATGACC
 
. : . : . : . : . : . :
rJMSF012K06- TGCCTGTTCTGCTAATACTGGCAA
JMSF012K06+ TGCCTGTTCTGCTAATACTGGCAACTTCCAGGCCACGATTCAAAGCTTCTTTGCAAATAT
JMFN010I10+ TGCCTGTTCTGCTAATACTGGCAACTTCCAGGCCACGATTCAAAGCTTCTTTGCAAATAT
JMSF039O17+ TGCCTGTTCTGCTAATACTGGCAACTTCCAGGCCACGATTCAAAGCTTCTTTGCAAATAT
JMFF046H21+ TGCCTGTTCTGCTAATACTGGCAACTTCCAGGCCACGATTCAAAGCTTCTTTGCAAATAT
JMFF005K05+ TGCCTGTTCTGCTAATACTGGCAACTTCCAGGCCACGATTCAAAGCTTCTTTGCAAATAT
JMSF025P11+ TGCCTGTTCTGCTAATACTGGCAACTTCCAGGCCACGATTCAAAGCTTCTTTGCAAATAT
                      ____________________________________________________________
consensus TGCCTGTTCTGCTAATACTGGCAACTTCCAGGCCACGATTCAAAGCTTCTTTGCAAATAT
 
. : . : . : . : . : . :
JMSF012K06+ GTGAGCCAACAAATCCATTTCCACCTAGCACCAGTATCTTGTCTGTAGGAGGCAAATTTA
JMFN010I10+ GTGAGCCAACAAATCCATTTCCACCTAGCACCAGTATCTTGTCTGTAGGAGGCAAATTTA
JMSF039O17+ GTGAGCCAACAAATCCATTTCCACCTAGCACCAGTATCTTGTCTGTAGGAGGCAAATTTA
JMFF046H21+ GTGAGCCAACAAATCCATTTCCACCTAGCACCAGTATCTTGTCTGTAGGAGGCAAATTTA
JMFF005K05+ GTGAGCCAACAAATCCATTTCCACCTAGCACCAGTATCTTGTCTGTAGGAGGCAAATTTA
JMSF025P11+ GTGAGCCAACAAATCCATTTCCACCTAGCACCAGTATCTTGTCTGTAGGAGGCAAATTTA
                      ____________________________________________________________
consensus GTGAGCCAACAAATCCATTTCCACCTAGCACCAGTATCTTGTCTGTAGGAGGCAAATTTA
 
. : . : . : . : . : . :
JMSF012K06+ CTGTTTCGGCTTCCTCAACTTTAAAAGGTTCATCTGTTTTGTTAGACTCACTTGAAAAAA
JMFN010I10+ CTGTTTCGGCTTCCTCAACTTTAAAAGGTTCATCTGTTTTGTTAGACTCACTTGAAAAAA
JMSF039O17+ CTGTTTCGGCTTCCTCAACTTTAAAAGGTTCATCTGTTTTGTTAGACTCACTTGAAAAAA
JMFF046H21+ CTGTTTCGGCTTCCTCAACTTTAAAAGGTTCATCTGTTTTGTTAGACTCACTTGAAAAAA
JMFF005K05+ CTGTTTCGGCTTCCTCAACTTTAAAAGGTTCATCTGTTTTGTTAGACTCACTTGAAAAAA
JMSF025P11+ CTGTTTCGGCTTCCTCAACTTTAAAAGGTTCATCTGTTTTGTTAGACTCACTTGAAAAAA
                      ____________________________________________________________
consensus CTGTTTCGGCTTCCTCAACTTTAAAAGGTTCATCTGTTTTGTTAGACTCACTTGAAAAAA
 
. : . : . : . : . : . :
JMSF012K06+ AGCGAGAATTTTTGGATGCAGAAATATACGAGAATCTGGAGAGGTAAAGTTTAGCGGCAG
JMFN010I10+ AGCGAGAATTTTTGGATGCAGAAATATACGAGAATCTGGAGAGGTAAAGTTTAGCGGCAG
JMSF039O17+ AGCGAGAATTTTTGGATGCAGAAATATACGAGAATCTGGAGAGGTAAAGTTTAGCGGCAG
JMFF046H21+ AGCGAGAATTTTTGGATGCAGAAATATACGAGAATCTGGAGAGGTAAAGTTTAGCGGCAG
JMFF005K05+ AGCGAGAATTTTTGGATGCAGAAATATACGAGAATCTGGAGAGGTAAAGTTTAGCGGCAG
JMSF025P11+ AGCGAGAATTTTTGGATGCAGAAATATACGAGAATCTGGAGAGGTAAAGTTTAGCGGCAG
                      ____________________________________________________________
consensus AGCGAGAATTTTTGGATGCAGAAATATACGAGAATCTGGAGAGGTAAAGTTTAGCGGCAG
 
. : . : . : . : . : . :
JMSF012K06+ AAGAATGGATCAAGCGTGACGTCATCGTCGATCGTCTCCTTTGTAATTGTGCGTTTGCGT
JMFN010I10+ AAGAATGGATCAAGCGTGACGTCATCGTCGATCGTCTCCTTTGTAATTGTGCGTTTGCGT
JMSF039O17+ AAGAATGGATCAAGCGTGACGTCATCGTCGATCGTCTCCTTTGTAATTGTGCGTTTGCGT
JMFF046H21+ AAGAATGGATCAAGCGTGACGTCATCGTCGATCGTCTCCTTTGTAATTGTGCGTTTGCGT
JMFF005K05+ AAGAATGGATCAAGCGTGACGTCATCGTCGATCGTCTCCTTTGTAATTGTGCGTTTGCGT
JMSF025P11+ AAGAATGGATCAAGCGTGACGTCATCGTCGATCGTCTCCTTTGTAATTGTGCGTTTGCGT
                      ____________________________________________________________
consensus AAGAATGGATCAAGCGTGACGTCATCGTCGATCGTCTCCTTTGTAATTGTGCGTTTGCGT
 
. : . : . : . : . : . :
JMSF012K06+ ACAGAAGCC
JMFN010I10+ ACAGAAGCCTCGCTTT
JMSF039O17+ ACAGAAGCCTCGCTTTTCCGCT
JMFF046H21+ ACAGAAGCCTCGCTTTTCCGCTGCTAATCCGCGAAAGATTCGATGCAGTTTAAGAC
JMFF005K05+ ACAGAAGCCTCGCTTTTCCGCT
JMSF025P11+ ACAGAAGCCTCGCTTTTCCGCTGCTAATCCGCGAAAGATTCGATGCAGTTTAAGACACTC
                      ____________________________________________________________
consensus ACAGAAGCCTCGCTTTTCCGCTGCTAATCCGCGAAAGATTCGATGCAGTTTAAGACACTC