Previous Contig 006333:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025O11Sequence212006333 (2)732013837 (2)gb:AK176238_18182267e-29Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-12-L14.
JMSF049J11Sequence190006333 (2)752013837 (2)gb:AK176238_18182262e-30Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-12-L14.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049J11+ AAAAAAA
JMSF025O11+ ANTTTACCCNATTNGNCCNTAGGGNAAAAAAA
                      ____________________________________________________________
consensus ANTTTACCCNATTNGNCCNTAGGGNAAAAAAA
 
. : . : . : . : . : . :
JMSF049J11+ AAAAAAAAAACTCCATTGATGGGTTCAGATTTTTTAATTTCGACGTACCCAATNCAATAT
JMSF025O11+ AAAAAAAAAACTCCATTGATGGGTTCAGATTTTTTAATTTCGACGTACCCAATACAATAT
                      ____________________________________________________________
consensus AAAAAAAAAACTCCATTGATGGGTTCAGATTTTTTAATTTCGACGTACCCAATACAATAT
 
. : . : . : . : . : . :
JMSF049J11+ ATTTGCTGCCTATAAATCAAATATTGAAATCATTTTTAAATTTTACATATTCCAAGAAGA
JMSF025O11+ ATTTGCTGCCTATAAATCAAATATTGAAATCATTTTTAAATTTTACATATTCCAAGAAGA
                      ____________________________________________________________
consensus ATTTGCTGCCTATAAATCAAATATTGAAATCATTTTTAAATTTTACATATTCCAAGAAGA
 
. : . : . : . : . : . :
JMSF049J11+ CAGGATTGTATCAAGCTTAAAGGAAAGCAGTAAAAACTATGTCTTGGGTAATTTAATTGC
JMSF025O11+ CAGGATTGTATCAAGCTTAAAGGAAAGCAGTAAAAACTATGTCTTGGGTAATTTAATTGC
                      ____________________________________________________________
consensus CAGGATTGTATCAAGCTTAAAGGAAAGCAGTAAAAACTATGTCTTGGGTAATTTAATTGC