Previous Contig 006330:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020F18Sequence655006330 (3)gb:ATAC009853_15430401e-23Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc753012438 (3)gb:ATAC009853_15430405e-17Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc
JMSF025N03Sequence662006330 (3)gb:ATAC009853_15430401e-23Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc748012438 (3)gb:ATAC009853_15430408e-15Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc
JMSF050M19Sequence655006330 (3)gb:ATAC009853_15430401e-26Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc718012438 (3)gb:ATAC009853_15430408e-20Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050M19+ GCGCCAAATAGTTGGCCCTAATC
JMSF020F18+ TC
JMSF025N03+ TC
                      ____________________________________________________________
consensus GCGCCAAATAGTTGGCCCTAATC
 
. : . : . : . : . : . :
JMSF050M19+ TCCAGCCAGTGAGCGTAGACGTACTCCACCAAGTCCACAACNTCGGCCGACGCGGATTCC
JMSF020F18+ TCCAGCCAGTGAGCGTAGACGTACTCCACCAAGTCCACAACCTCGGCCGACGCGGATTCC
JMSF025N03+ TCCAGCCAGTGAGCGTAGACGTACTCCACCAAGTCCACAACCTCGGCCGACGCGGATTCC
                      ____________________________________________________________
consensus TCCAGCCAGTGAGCGTAGACGTACTCCACCAAGTCCACAACCTCGGCCGACGCGGATTCC
 
. : . : . : . : . : . :
JMSF050M19+ ACCGTAGGCGGACTAAAATGCCATCCTTTGAAGTAAGCAATTAGCTCGAAGAGTAGCAGA
JMSF020F18+ ACCGTAGGCGGACTAAAATGCCATCCTTTGAAGTAAGCAATTAGCTCGAAGAGTAGCAGA
JMSF025N03+ ACCGTAGGCGGACTAAAATGCCATCCTTTGAAGTAAGCAATTAGCTCGAAGAGTAGCAGA
                      ____________________________________________________________
consensus ACCGTAGGCGGACTAAAATGCCATCCTTTGAAGTAAGCAATTAGCTCGAAGAGTAGCAGA
 
. : . : . : . : . : . :
JMSF050M19+ AGCACGGAGACCGTCAAAAACACCTTAATTACCCGATACAACCGGGACTCCGCTCTCGGC
JMSF020F18+ AGCACGGAGACCGTCAAAAACACCTTAATTACCCGATACAACCGGGACTCCGCTCTCGGC
JMSF025N03+ AGCACGGAGACCGTCAAAAACACCTTAATTACCCGATACAACCGGGACTCCGCTCTCGGC
                      ____________________________________________________________
consensus AGCACGGAGACCGTCAAAAACACCTTAATTACCCGATACAACCGGGACTCCGCTCTCGGC
 
. : . : . : . : . : . :
JMSF050M19+ GCGGCGGAACTGGAGGCCGCGATACGGCGATTGGCGGTGCGGACGATAGAGATGAAGCTA
JMSF020F18+ GCGGCGGAACTGGAGGCCGCGATACGGCGATTGGCGGTGCGGACGATAGAGATGAAGCTA
JMSF025N03+ GCGGCGGAACTGGAGGCCGCGATACGGCGATTGGCGGTGCGGACGATAGAGATGAAGCTA
                      ____________________________________________________________
consensus GCGGCGGAACTGGAGGCCGCGATACGGCGATTGGCGGTGCGGACGATAGAGATGAAGCTA
 
. : . : . : . : . : . :
JMSF050M19+ TTGGTGATGAACGCGACTGAGCCGGCGATTTGCTGGATTTTAATGAGGTAAATCCAGGAC
JMSF020F18+ TTGGTGATGAACGCGACTGAGCCGGCGATTTGCTGGATTTTAATGAGGTAAATCCAGGAC
JMSF025N03+ TTGGTGATGAACGCGACTGAGCCGGCGATTTGCTGGATTTTAATGAGGTAAATCCAGGAC
                      ____________________________________________________________
consensus TTGGTGATGAACGCGACTGAGCCGGCGATTTGCTGGATTTTAATGAGGTAAATCCAGGAC
 
. : . : . : . : . : . :
JMSF050M19+ AGCTGCCGAGCGCTGCGAGTCCGTTCCTTGTCCAATGCGCCATCGCCGCTAGGGCTGCGG
JMSF020F18+ AGCTGCCGAGCGCTGCGAGTCCGTTCCTTGTCCAATGCGCCATCGCCGCTAGGGCTGCGG
JMSF025N03+ AGCTGCCGAGCGCTGCGAGTCCGTTCCTTGTCCAATGCGCCATCGCCGCTAGGGCTGCGG
                      ____________________________________________________________
consensus AGCTGCCGAGCGCTGCGAGTCCGTTCCTTGTCCAATGCGCCATCGCCGCTAGGGCTGCGG
 
. : . : . : . : . : . :
JMSF050M19+ ATCTCCACATTCAAAAAGCTATGCGATTCCGCGGAGGACGGCGAAGCGCCGGAAGACGAG
JMSF020F18+ ATCTCCACATTTAAAAAGCTATGCGATTCCGCGGAGGACGGCGAAGCGCCGGAAGACGAG
JMSF025N03+ ATCTCCACATTCAAAAAGCTATGCGATTCCGCGGAGGACGGCGAAGCGCCGGAAGACGAG
                      ____________________________________________________________
consensus ATCTCCACATTCAAAAAGCTATGCGATTCCGCGGAGGACGGCGAAGCGCCGGAAGACGAG
 
. : . : . : . : . : . :
JMSF050M19+ CCGGAAGAGAAGACGCCATTGTCCTCCTCCACCCTCTGCTTATTCCACCACTCTTGAAAC
JMSF020F18+ CCGGAAGAGAAGACGCCATTGTCCTCCTCCACCCTCTGCTTATTCCACCACTCTTGAAAC
JMSF025N03+ CCGGAAGAGAAGACGCCATTGTCCTCCTCCACCCTCTGCTTATTCCACCACTCTTGAAAC
                      ____________________________________________________________
consensus CCGGAAGAGAAGACGCCATTGTCCTCCTCCACCCTCTGCTTATTCCACCACTCTTGAAAC
 
. : . : . : . : . : . :
JMSF050M19+ TCATAGTTTGGCTGCCGAGACATATATAGAACACAAACAACAATCCAACAATTATATGAT
JMSF020F18+ TCATAGTTTGGCTGCCGAGACATATATAGAACACAAACAACAATCCAACAATTATATGAT
JMSF025N03+ TCATAGTTTGGCTGCCGAGACATATATAGAACACAAACAACAATCCAACAATTATATGAT
                      ____________________________________________________________
consensus TCATAGTTTGGCTGCCGAGACATATATAGAACACAAACAACAATCCAACAATTATATGAT
 
. : . : . : . : . : . :
JMSF050M19+ TATGCGCCCCTCGAGATTTCGCCTTTCCAGATCCGGATTCTGGTCTATCGGCGACGGTGA
JMSF020F18+ TATGCGCCCCTCGAGATTTCGCCTTTCCAGATCCGGATTCTGGTCTATCGGCGACGGTGA
JMSF025N03+ TATGCGCCCCTCGAGATTTCGCCTTTCCAGATCCGGATTCTGGTCTATCGGCGACGGTGA
                      ____________________________________________________________
consensus TATGCGCCCCTCGAGATTTCGCCTTTCCAGATCCGGATTCTGGTCTATCGGCGACGGTGA
 
. : . : . : . : . : . :
JMSF050M19+ ATCATGGCCGCGCGTGCGTGCGTGATCCGGT
JMSF020F18+ ATCATGGCCGCGCGTGCGTGCGTGATCCGGTGACTGGGGACGGATTATTAC
JMSF025N03+ ATCATGGCCGCGCGTGCGTGCGTGATCCGGTGACTGGGGACGGATTATTACAAAAAACCC
                      ____________________________________________________________
consensus ATCATGGCCGCGCGTGCGTGCGTGATCCGGTGACTGGGGACGGATTATTACAAAAAACCC