Previous Contig 006324:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS048G11Sequence590006324 (10)gb:AF367304_17917564e-19Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.
JMFS056C10Sequence623006324 (10)gb:AF367304_17917562e-26Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.
JMFS056D01Sequence479006324 (10)gb:AK117747_18157642e-08Arabidopsis thaliana At5g36940 mRNA for putative cationic amino acid transporter
JMFS149E07Sequence553006324 (10)gb:AF367304_17917567e-34Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.
JMSF025L24Sequence396006324 (10)751013419 (6)gb:AK117747_18157649e-51Arabidopsis thaliana At5g36940 mRNA for putative cationic amino acid transporter
JMSF025M09Sequence676006324 (10)gb:AF367304_17917562e-22Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.791013419 (6)gb:AK117747_18157643e-41Arabidopsis thaliana At5g36940 mRNA for putative cationic amino acid transporter
JMSF029I13Sequence593006324 (10)gb:AF367304_17917561e-09Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.724013419 (6)gb:AK117747_18157645e-42Arabidopsis thaliana At5g36940 mRNA for putative cationic amino acid transporter
JMSF042H24Sequence700006324 (10)gb:AF367304_17917562e-63Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.700013419 (6)gb:AF531371_18093121e-37Gossypium barbadense fiber protein Fb12 mRNA, partial cds.
JMSF050J01Sequence619006324 (10)gb:AF367304_17917562e-25Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.742013419 (6)gb:AK117747_18157649e-43Arabidopsis thaliana At5g36940 mRNA for putative cationic amino acid transporter
JMSF052B04Sequence679006324 (10)gb:AF367304_17917562e-61Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.804013419 (6)gb:AK117747_18157641e-42Arabidopsis thaliana At5g36940 mRNA for putative cationic amino acid transporter

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042H24+ ATTCCCACACACAAAAGCCCCGT
                      ____________________________________________________________
consensus ATTCCCACACACAAAAGCCCCGT
 
. : . : . : . : . : . :
JMSF052B04+ TACAATACNAACTAATAATGCTGCACATGGATCCACTACAATGTTAAGCCCGGGGATGGT
JMSF042H24+ TACAATACAAANTAATAATGNTGCACATGGATCCANTACAATGTTAAGCCCGGGGATGGT
                      ____________________________________________________________
consensus TACAATACAAACTAATAATGCTGCACATGGATCCACTACAATGTTAAGCCCGGGGATGGT
 
. : . : . : . : . : . :
JMSF052B04+ GTGACGAGCTAAAAAGACCGGGAGACTGTCTTGTCCTCCAAAGAGCAAGGCCAGGTTTGG
JMSF042H24+ GTGACGAGNTAAAAAGACCGGGAGACTGTCTTGTCCTCCAAAGAGCAAGGCCAGGTTTGG
                      ____________________________________________________________
consensus GTGACGAGCTAAAAAGACCGGGAGACTGTCTTGTCCTCCAAAGAGCAAGGCCAGGTTTGG
 
. : . : . : . : . : . :
JMSF052B04+ AGATATGCCCCGTGCCACTGCAGAACCTCCAATTGTGTATTCCAATATCAGCCCCCACCC
JMSF042H24+ AGATATGCCCCGTGCCACTGCAGAACCTCCAATTGTGTATTCCAATATCAGCCCCCACCC
JMFS149E07+ ATCAGCCCCCACCC
                      ____________________________________________________________
consensus AGATATGCCCCGTGCCACTGCAGAACCTCCAATTGTGTATTCCAATATCAGCCCCCACCC
 
. : . : . : . : . : . :
JMSF052B04+ AATTAACCAAGCAACTCCTTCTCCGACGCATATGTAAGAATAATGATATGCACTCCCAGC
JMSF042H24+ AATTAACCAAGCAACTCCTTCTCCGACGCATATGTAAGAATAATGATATGCACTCCCAGC
JMFS149E07+ AATTAACCAAGCAACTCCTTCTCCGACGCATATGTAAGAATAATGATATGCACTCCCAGC
JMFS056C10+ CCGACGCATATGTAAGAATAATGATATGCACTCCCAGC
JMSF050J01+ GATATGCACTCCCAGC
JMFS048G11+ CCAGC
JMSF025M09+ ATGATATGCACTCCCAGC
                      ____________________________________________________________
consensus AATTAACCAAGCAACTCCTTCTCCGACGCATATGTAAGAATAATGATATGCACTCCCAGC
 
. : . : . : . : . : . :
JMSF052B04+ CGAGGGACAACGACTGGAAAGCTCGGCATAGCAGAGGGCGGAAAGAGCAGCTGCTAT-CC
JMSF042H24+ CGAGGGACAACGACTGGAAAGCTCGGCATAGCAGAGGGCGGAAAGAGCAGCTGCTAT-CC
JMFS149E07+ CGAGGGACAACGACTGGAAAGCTCGGCATAGCAGAGGGCGGAAAGAGCAGCTGCTAT-CC
JMFS056C10+ CGAGGGACAACGACTGGAAAGCTCGGCATAGCAGAGGGCGGAAAGAGCAGCTGCTAT-CC
JMSF050J01+ CGAGGGACAACGACTGGAAAGCTCGGCATAGCAGAGGGCGGAAAGAGCAGCTGCTATCCC
JMFS048G11+ CGAGGGACAACGACTGGAAAGCTCGGCATAGCAGAGGGCGGAAAGAGCAGCTGCTAT-CC
JMSF025M09+ CGAGGGACAACGACTGGAAAGCTCGGCATAGCAGAGGGCGGAAAGAGCAGCTGCTAT-CC
                      ____________________________________________________________
consensus CGAGGGACAACGACTGGAAAGCTCGGCATAGCAGAGGGCGGAAAGAGCAGCTGCTAT-CC
 
. : . : . : . : . : . :
JMSF052B04+ CCGCTATTAAAAATGAAAAGGCGAGGGCTGGGCCAGAATGCTCTCTCGCAACTGTCCCAA
JMSF042H24+ CCGCTATTAAAAATGAAAAGGCGAGGGCTGGGCCAGAATGCTCTCTCGCAACTGTCCCAA
JMFS149E07+ CCGCTATTAAAAATGAAAAGGCGAGGGCTGGGCCAGAATGCTCTCTCGCAACTGTCCCAA
JMFS056C10+ CCGCTATTAAAAATGAAAAGGCGAGGGCTGGGCCAGAATGCTCTCTCGCAACTGTCCCAA
JMSF050J01+ CCGCTATTAAAAATGAAAAGGCGAGGGCTGGGCCAGAATGCTCTCTCGCAACTGTCCCAA
JMFS056D01+ GCAACTGTCCCAA
JMFS048G11+ CCGCTATTAAAAATGAAAAGGCGAGGGCTGGGCCAGAATGCTCTCTCGCAACTGTCCCAA
JMSF025M09+ CCGCTATTAAAAATGAAAAGGCGAGGGCTGGGCCAGAATGCTCTCTCGCAACTGTCCCAA
                      ____________________________________________________________
consensus CCGCTATTAAAAATGAAAAGGCGAGGGCTGGGCCAGAATGCTCTCTCGCAACTGTCCCAA
 
. : . : . : . : . : . :
JMSF052B04+ CTAGAATATAAACCCCTGCACCTATAGTTGAACCAACACCTATGGCAATGAGATGAGGGA
JMSF042H24+ CTAGAATATAAACCCCTGCACCTATAGTTGAACCAACACCTATGGCAATGAGATGAGGGA
JMFS149E07+ CTAGAATATAAACCCCTGCACCTATAGTTGAACCAACACCTATGGCAATGAGATGAGGGA
JMFS056C10+ CTAGAATATAAACCCCTGCACCTATAGTTGAACCAACACCTATGGCAATGAGATGAGGGA
JMSF050J01+ CTAGAATATAAACCCCTGCACCTATAGTTGAACCAACACCTATGGCAATGAGATGAGGGA
JMFS056D01+ CTAGAATATAAACCCCTGCACCTATAGTTGAACCAACACCTATGGCAATGAGATGAGGGA
JMFS048G11+ CTAGAATATAAACCCCTGCACCTATAGTTGAACCAACACCTATGGCAATGAGATGAGGGA
JMSF029I13+ ATAGTTGAACCAACACNTATGGCAATGAGATGAGGGA
JMSF025M09+ CTAGAATATAAACCCCTGCACCTATAGTTGAACCAACACCTATGGCAATGAGATGAGGGA
                      ____________________________________________________________
consensus CTAGAATATAAACCCCTGCACCTATAGTTGAACCAACACCTATGGCAATGAGATGAGGGA
 
. : . : . : . : . : . :
JMSF052B04+ CAGTCAAGGCTTTGGCCAACTGGTGATCTCCACCATGCCCAGAAGCAGAGGATGAAGACT
JMSF042H24+ CAGTCAAGGCTTTGGCCAACTGGTGATCTCCACCATGCCCAGAAGCAGAGGATGAAGACT
JMFS149E07+ CAGTCAAGGCTTTGGCCAACTGGTGATCTCCACCATGCCCAGAAGCAGAGGATGAAGACT
JMFS056C10+ CAGTCAAGGCTTTGGCCAACTGGTGATCTCCACCATGCCCAGAAGCAGAGGATGAAGACT
JMSF050J01+ CAGTCAAGGCTTTGGCCAACTGGTGATCTCCACCATGCCCAGAAGCAGAGGATGAAGACT
JMFS056D01+ CAGTCAAGGCTTTGGCCAACTGGTGATCTCCACCATGCCCAGAAGCAGAGGATGAAGACT
JMFS048G11+ CAGTCAAGGCTTTGGCCAACTGGTGATCTCCACCATGCCCAGAAGCAGAGGATGAAGACT
JMSF029I13+ CAGTCAAGGCTTNGGCCAANTGGTGATNTCCNCCATGCCCAGAAGCAGAGGATGAAGACT
JMSF025M09+ CAGTCAAGGCTTTGGCCAACTGGTGATCTCCACCATGCCCAGAAGCAGAGGATGAAGACT
                      ____________________________________________________________
consensus CAGTCAAGGCTTTGGCCAACTGGTGATCTCCACCATGCCCAGAAGCAGAGGATGAAGACT
 
. : . : . : . : . : . :
JMSF052B04+ TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
JMSF042H24+ TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
JMFS149E07+ TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
JMFS056C10+ TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
JMSF050J01+ TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
JMFS056D01+ TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
JMFS048G11+ TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
JMSF025L24+ CTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
JMSF029I13+ TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
JMSF025M09+ TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
                      ____________________________________________________________
consensus TTGAATGGGCAGAATCAACCTTCTTCCTCCTCACAAGGCATCTCAACCCACCAGAAAATC
 
. : . : . : . : . : . :
JMSF052B04+ CA-CCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
JMSF042H24+ CA-CCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
JMFS149E07+ CA-CCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
JMFS056C10+ CA-CCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
JMSF050J01+ CA-CCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
JMFS056D01+ CA-CCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
JMFS048G11+ CA-CCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
JMSF025L24+ CACCCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
JMSF029I13+ CACCCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
JMSF025M09+ CA-CCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAAGAAATCTTCAATTC
                      ____________________________________________________________
consensus CA-CCCCCATCGCCACTCCTTTCCCAATCAGACACAACCCCCATAACAAATCTTCAATTC
 
. : . : . : . : . : . :
JMSF052B04+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
JMSF042H24+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
JMFS149E07+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
JMFS056C10+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
JMSF050J01+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
JMFS056D01+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
JMFS048G11+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
JMSF025L24+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
JMSF029I13+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
JMSF025M09+ CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
                      ____________________________________________________________
consensus CCAACTTTCCCTATTCACAAAATTTGATCTTTTTTCTAATTTCCCACTCTACTTTTTACA
 
. : . : . : . : . : . :
JMSF052B04+ ATTTATGTATATGAAAC
JMSF042H24+ ATTTATGTATATGAAACT
JMFS149E07+ ATTTATGTATATGAAACTGTGAAAGTATGTACAAAGTGGGTGCTTTATATCAAATCAATT
JMFS056C10+ ATTTATGTATATGAAACTGTGAAAGTATGTACAAAGTGGGTGCTTTATATCAAATCAATT
JMSF050J01+ ATTTATGTATATGAAACTGTGAAAGTATGTACAAAGTGGGTGCTTTATATCAAATCAATT
JMFS056D01+ ATTTATGTATATGAAACTGTGAAAGTATGTACAAAGTGGGTGCTTTATATCAAATCAATT
JMFS048G11+ ATTTATGTATATGAAACTGTGAAAGTATGTACAAAGTGGGTGCTTTATATCAAATCAATT
JMSF025L24+ ATTTATGTATATGAAACTGTGAAAGTATGTACAAAGTGGGTGCTTTATATCAAATCAATT
JMSF029I13+ ATTTATGTATATGAAACTGTGAAAGTATGTACAAAGTGGGTGCTTTATATCAAATCAATT
JMSF025M09+ ATCTATGTATATGAAACTGTGAAAGTATGTACAAAGTGGGTGCTTTATATCAAATCAATT
                      ____________________________________________________________
consensus ATTTATGTATATGAAACTGTGAAAGTATGTACAAAGTGGGTGCTTTATATCAAATCAATT
 
. : . : . : . : . : . :
JMFS149E07+ A
JMFS056C10+ ATTCACAAATCACAAGGCTGTATAGTGTATAGTACAAAATCTACAGGAGAAAGTGAGGGA
JMSF050J01+ ATTCACAAATCACAAGGCTGTATAGTGTATAGTACGAAATCTACAGGAGAAAGTGAGGGA
JMFS056D01+ ATTCACAAATCACAAGGCTGTATAGTGTATAGTACAAAATCTACAGGAGAAAGTGAGGGA
JMFS048G11+ ATTCACAAATCACAAGGCTGTATAGTGTATAGTACAAAATCTACAGGAGAAAGTGAGGGA
JMSF025L24+ ATTCACAAATCACAAGGCTGTATAGTGTATAGTACAAAATCTACAGGAGAAAGTGAGGGA
JMSF029I13+ ATTCACAAATCACAAGGCTGTATAGTGTATAGTACAAAATCTACAGGAGAAAGTGAGGGA
JMSF025M09+ ATTCACAAATCACAAGGCTGTATAGTGTATAGTACAAAATCTACAGGAGAAAGTGAGGGA
                      ____________________________________________________________
consensus ATTCACAAATCACAAGGCTGTATAGTGTATAGTACAAAATCTACAGGAGAAAGTGAGGGA
 
. : . : . : . : . : . :
JMFS056C10+ AGATGGGGGAAGTGAGGTTGAGGTGCCCCTGACAGCAACCCGGGAAG
JMSF050J01+ AGATGGGGGAAGTGAGGTTGAGGTGCCCCTGACAGCAACCCGGGAAGGAGACGGCTGCTG
JMFS056D01+ AGATGGGGGAAGTGAGGTTGAGGTGCCCCTGACAGCAACCCGGGAAG
JMFS048G11+ AGATGGGGGAAGTGAGGTTGAGGTGCCCCTGACAGCAACCCGGGAAG
JMSF025L24+ AGATGGGGGAAGTGAGGTTGAGGTGCCCCTGACAGCAACCCGGGAAGGAGACGGCTGCTG
JMSF029I13+ AGATGGGGGAAGTGAGGTTGAGGTGCCCCTGACAGCAACCCGGGAAGGAGACGGCTGCTG
JMSF025M09+ AGATGGGGGAAGTGAGGTTGAGGTGCCCCTGACAGCAACCCGGGAAGGAGACGGCTGCTG
                      ____________________________________________________________
consensus AGATGGGGGAAGTGAGGTTGAGGTGCCCCTGACAGCAACCCGGGAAGGAGACGGCTGCTG
 
. : . : . : . : . : . :
JMSF050J01+ A
JMSF025L24+ AACAGGCAGAGATCAACTGCCAAAGATCAAAGATCACGTTTTCAGATACACGATCCTC
JMSF029I13+ AACAGGCAGAGATCAACTGCCAAAGATCAAAGATCACGTTTTCAGATACACGATCCTC
JMSF025M09+ AACAGGCAGAGATCAACTGCCAAAGATCAAAGATCACGTTTTCAGATACACGATCCTCCA
                      ____________________________________________________________
consensus AACAGGCAGAGATCAACTGCCAAAGATCAAAGATCACGTTTTCAGATACACGATCCTCCA